formation of a seaweed bed using carbon fibers

Báo cáo y học: " De novo genome sequence assembly of a filamentous fungus using Sanger, 454 and Illumina sequence data" ppsx

Báo cáo y học: " De novo genome sequence assembly of a filamentous fungus using Sanger, 454 and Illumina sequence data" ppsx

... alternative information such as reads with mate pairs anchored in a scaffold, polymorphisms within a repeat family, or the combination of a low probability overlap and read-pair data An important advance ... Illumina PE read data and Illumina with Sanger PE read data (see Materi-als and methods: Assembling Illumina data); using Forge we assessed assemblies generated from 454 SE read data, 454 SE with Sanger ... library of approximately 200-bp sheared genomic DNA frag-ments on an Illumina GAii (approximately 3.3 Gb of sequence data; approximately 100-fold genome sequence coverage) Initial assembly analysis...

Ngày tải lên: 09/08/2014, 20:20

12 621 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... expected, was respira-tory-deficient because of the absence of the catalytic subunit ISP (Table 1) Figure 3A shows that a band of approximately 500 kDa was also found in this mutant strain when ... oxidase complex was clearly demonstrated [10–12], but also in other organisms, such as Neurospora crassa [13], mammals [11] and plants [14] A higher-order organization of the respiratory chain ... strain exhibited a reduced growth rate on nonfermentable carbon sources Figure 4A shows that a band of approximately 500 kDa was found in both yeast mutant strains when the mitochon-drial membranes...

Ngày tải lên: 18/02/2014, 08:20

15 641 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

... dehydrogenase (a, 141 kDa) and catalase (250 kDa) were loaded on to a separate gradient as mole-cular mass markers. Trang 9Not only the aggregate but also the covalently linkeddimer almost disappeared ... dehydrogenase (a, 141 kDa) and catalase (c, 250 kDa) were loaded on to a separate gradient as molecular mass markers. Trang 10mutations such as TNSALP (R54C), TNSALP(N153D), TNSALP (E218G), TNSALP ... bone and tooth TNSALP-deficient mice develop rickets and osteope-nia postnatally and many die of seizure [4–6], recapit-ulating infantile hypophosphatasia Additionally, as with hypophosphatasia patients,...

Ngày tải lên: 19/02/2014, 17:20

14 446 0
Báo cáo " Calibration and verification of a hydrological model using event data " ppt

Báo cáo " Calibration and verification of a hydrological model using event data " ppt

... was taken as a case study (Figure 3.1). The basin has an area of about 275 km 2 , a perimeter of 111.9 km and an average rainfall of 2500 mm/year. In Quang Tri, there are a wet and a dry ... peak flow of observation is much higher than that of simulation. This can be attributed to both of the large interval of rainfall data and the changes of basin characteristics. The calibrated ... of these parameters on the total runoff volume and on the peak of the runoff. Their conclusions are shown in table 2.2. Table 2.1. NAM parameter explanation and boundaries NAM Parameter NAM...

Ngày tải lên: 22/03/2014, 12:20

11 441 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx

Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx

... fraction between peaks in chromatographic profile shown in Fig 3) (B) Analysis of a standard mixture containing Glc, Gal, Man, Fuc, GlcNAc, GalNAc, ManNAc (C) Analysis of peak 1 (Fig 3A) (D) Analysis ... unequivocal conclusions Fig 4 RP-HPLC analysis of carbohydrate content of the Ru strain CP N-terminal peptide Monosaccharides were analyzed as AMC derivatives (A) Analysis of a blank sample (eluate ... Elena V Lukashina1, Andrey N Kharlanov2, Vitaly V Nasonov3, Marina V Serebryakova4, Stanislav V Kozlovsky1, Olga V Zayakina1and Nina P Rodionova1 1 A N Belozersky Institute of Physico-Chemical...

Ngày tải lên: 23/03/2014, 13:20

10 399 0
Source investigation of a small event using empirical Green’s functions and simulated annealing ppt

Source investigation of a small event using empirical Green’s functions and simulated annealing ppt

... motion data (Hartzell 1978; Fukuyama & 768 Irikura 1986), as well as regional and teleseismic body and surface waveforms (Hartzell 1989; Kanamori ef al 1992; Velasco, Ammon & Lay 1994) ... effective active area on the fault This gives us values of the average total slip of between 0.1 and 1 cm and a stress drop of between I and 10 bar for a rise time equal to At, and a stress drop that ... of solution, and also the uncertainties contained in the data itself, we propose the decreasing of the temperature to a critical value equal to the noise variance of the data This value is calculated...

Ngày tải lên: 23/03/2014, 13:20

13 487 0
Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc

Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc

... AglC was tested towards 5 mm pNPaGal, pNPaGalNAc, pNPaAra, pNPaAraf, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha, pNPaXyl, and pNPbGal, and 0.4% galactomannans in 40 mm Na acetate pH 5.0, 0.02% BSA, ... trehalactu-lose, turanose, raffi-nose, pNPaAra, pNPaAraf, pNPaGal, pNPaGalNAc, pNPbGal, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha and pNPaXyl were purchased from Sigma (St Louis, MO, USA) Galactomannans ... mixture of a- and b-galactose from Oryza sativa a-galactosidase [28], N-acetyl-a-galactosamine from Gallus gallus a-N-acet-ylgalactosaminidase [29] and melibiose from human a-galactosidase [27]...

Ngày tải lên: 29/03/2014, 21:20

14 579 0
Báo cáo khoa học: Solubility-dependent structural formation of a 25-residue, natively unfolded protein, induced by addition of a seven-residue peptide fragment pot

Báo cáo khoa học: Solubility-dependent structural formation of a 25-residue, natively unfolded protein, induced by addition of a seven-residue peptide fragment pot

... Ile, Val, Ala, Phe, Cys and Met, which have notably larger hydration potentials (greater than )2 kcalÆmol)1) than those of any other amino acids (less than )5 kcalÆmol)1), as candidates for amino ... of Pro and Arg side chains and the backbone are taken from the values measured by Privalov et al [17] pK values of the amino acid side chains, a-COOH and a-NH 3+ termini are taken from the values ... that some distance restraints are because of intermolecular interactions caused by the added fragment However, the ratio of long-range NOEs related to the added fragment to the total of long-range...

Ngày tải lên: 29/03/2014, 23:20

12 339 0
Hints towards the formation of a more comprehensive theory of life. pptx

Hints towards the formation of a more comprehensive theory of life. pptx

... certain of thelatter, and unappropriating them to a yet unnamed triplicity; or that, being thus assisted, we may obtain aqualitative instead of a quantitative insight into vegetable animation, as ... plastering, sawing, planing, &c were the offspring of the house; and that the masonand carpenter were the result of a suite of chambers, with the passages and staircases that lead to them Tomake A the ... proof of theessential vitality of nature, that she does not ascend as links in a suspended chain, but as the steps in a ladder; or rather she at one and the same time ascends as by a climax, and...

Ngày tải lên: 30/03/2014, 01:20

40 448 0
Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot

Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot

... carried out on five different animals of each strain. Animal Treatment a Total calpastatin activity (%) b 15 kDa fragment activity (%) c Loss of total calpastatin activity (%) d Brain Aorta a ... Table 1 Levels of native and 15 kDa calpastatin species in brain and aorta of NMS and HMS rats treated with HSD for 4 weeks. The data reported are the arithmetical means ± standard deviation of ... 15 kDa fragments (Table 1), whereas, in aorta, the inhibitor was predominantly inactivated As both the inactivation and fragmentation of calpastatin are known to be produced by active calpain...

Ngày tải lên: 30/03/2014, 04:20

11 345 0
Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx

Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx

... as a tetramer of Coq1–Dps1, with the molecular mass of GST-Coq1 calculated as 72 kDa and HA-Dps1 as 43 kDa The Coq1–Dps1 band was seen at the same position in the crude extract of LA1 harbouring ... Trang 1synthase from fission yeast Dps1 and buddingyeast Coq1* Mei Zhang, Jun Luo, Yuki Ogiyama, Ryoichi Saiki and Makoto Kawamukai Department of Applied Bioscience and Biotechnology, Faculty of ... We extracted RNAs from S cerevisiae strain W3031A, and mRNAs were used as a template for RT-PCR to obtain a first-strand cDNA (Fig 2B) The cDNA of COQ1 was cloned into a pT7-Blue vector and then...

Ngày tải lên: 30/03/2014, 04:20

16 315 0
báo cáo hóa học:" Identification of a biomarker panel using a multiplex proximity ligation assay improves accuracy of pancreatic cancer diagnosis" doc

báo cáo hóa học:" Identification of a biomarker panel using a multiplex proximity ligation assay improves accuracy of pancreatic cancer diagnosis" doc

... Conclusions: A multiplex panel assaying CA19-9, OPN and CHI3L1 in plasma improves accuracy of pancreatic cancer diagnosis A panel assaying CEA and CA125 in plasma can predict survival for this clinical ... diagnostic accuracy compared to CA19-9 alone, our study was limited to patients with locally advanced pan-creatic cancer Although extrapolation of these data to an asymptomatic population as a potential ... a proximity ligation assay (PLA) to measure the levels of 21 tumor markers in the plasma of a cohort of 52 patients with unresectable, advanced pancreatic cancer as well as a cohort of 43 healthy,...

Ngày tải lên: 18/06/2014, 15:20

12 450 0
CARBON NANOTUBES 2012 pptx

CARBON NANOTUBES 2012 pptx

... groups for carbon nanotubes can be either symmorphic [such as armchair (n,n)and zigzag Physics of carbon nanotubes 29 Table Parameters of carbon nanotubes Symbol _ Name Value Formula carbon- carbon ... 1 0a results in a cylinder that has a diameter (ca nm) and a 22 -carbon atom repeat cycle and a single hexagon screw pitch -the smallest archetypal (isolated pentagon) example of a graphene nanotube ... field of carbon nanotubes is marked by the publication by Iijima of the observation of multi-walled nanotubes with outer diameters as small as 55 A, and inner diameters as small as 23 A, and a nanotube...

Ngày tải lên: 05/03/2014, 15:21

202 594 0
Long run effects of government policy in the growth model with creative destruction

Long run effects of government policy in the growth model with creative destruction

... preferable states with maximal social welfare and optimal growth rate in growth theory, because it lacks theoretical guarantee that a decentralized economy will automatically evolve into an optimal ... time paths of variables such as per capita capital asset, leading-edge productivity and variety of intermediate goods 4.1 Steady-State Equilibrium Results of Social Planner’s Economy At any given ... t Stationary is also imposed on the fraction of Qt At Qt At Qt At final output allocated to vertical R&D nt , the fraction of final output allocated to horizontal R&D ht , and interest rate rt...

Ngày tải lên: 10/11/2015, 11:07

79 269 0
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

... fluorescent images of their dendrites were analyzed with neurolucida software (MBF Bioscience, Williston, VT, USA) Image data were statistically quantified by repeated-measures analysis of variance with ... M1406; Sigma-Aldrich), EGFP (catalog number: SC-9996; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), Flag (catalog number: 3165; Sigma-Aldrich) and HA (catalog number: 1867423; Roche Diagnostics, ... neurons A previous in vitro study indicated that the RasGEF activity of v-KIND induces the phosphorylation of MAP2 by JNK1 and ⁄ or ERK via the activation of the Ras–Raf–MAP kinase pathway [12]...

Ngày tải lên: 14/02/2014, 19:20

11 659 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... was obtained by PCR from the plasmid pET21 SIC1 [32] with a forward primer (5Â-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3Â) designed to introduce a hexahistidine tag and a ClaI ... hexahistidine tag was obtained by PCR using the pET2 1a PNT-H6 plasmid [30] as the template The forward primer (5Â-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3Â) was designed to insert a ClaI restriction ... disappearance of the full-length polypeptide as early as after of incubation Proteolysis of PNT-GFP proceeded with the formation of a relatively stable fragment with an apparent mass of 31 kDa...

Ngày tải lên: 18/02/2014, 04:20

14 675 0
Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc

Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc

... conjugated upper primer was 5¢-GGAATTCCGCCACCATGCCATA CGATGTTCCAGATTACGCT-3¢ The XbaI restriction site-conjugated lower primer was 5¢-GCTCTAGAGCTCA TTTCCGACTGAAGA-3¢ Amplification of bcl-XL cDNA was ... addition of ADR, and used for immunoblot analysis of pro-caspase and caspase (C) Cells were treated with EGF and ADR as described in (A) Lysates were prepared at the indicated times after the ADR addition ... addition and analyzed for caspase activity by using a fluorometric substrate-based assay Each point is the mean of triplicate samples, and the bar represents the standard deviation Similar results...

Ngày tải lên: 19/02/2014, 06:20

13 496 0
Tài liệu Economic Reforms, Foreign Direct Investment and its Economic Effects in India pdf

Tài liệu Economic Reforms, Foreign Direct Investment and its Economic Effects in India pdf

... non-traditional export industries, whereas Japanese FDI has not The extremely short account of India’s reform program draws on Kumar (2003), Balasubramanyam and Mahambare (2003), Agrawal (2005) and Gupta ... sector appears to be concentrated in 27 For the importance of trade liberalization, financial liberalization and human capital formation as catalysts to more favorable growth effects of FDI, see Balasubramanyam ... Central Statistical Organisation (var iss.); Reserve Bank of India (Database on Indian Economy) 40 Table — FDI Characteristics, 1990-91 and 2002-03 Raw Memorandum Imports of materials, Value of...

Ngày tải lên: 21/02/2014, 01:20

45 515 0
w