fleshing out a standardized format

 Báo cáo y học: " A Dietary Supplement Containing Standardized Phaseolus vulgaris Extract Influences Body Composition of Overweight Men and Women"

Báo cáo y học: " A Dietary Supplement Containing Standardized Phaseolus vulgaris Extract Influences Body Composition of Overweight Men and Women"

... a purified alpha-amylase inhibitor from white kidney bean (Phaseolus vulgaris). Food Re- search International, 1998; 31:217-225. 17. Hansawasdi C, Kawabata J, Kasai T. Alpha-amylase inhibitors ... placebo or a test formula containing a starch blocker as the principal active ingredient. [Phase 2 Starch Neutralizer TM , also known as Phaseolamin 2250 TM and Phase2 TM (Pharmachem Laboratories, ... Purification and partial characterization of two alpha-amylase inhibitors from black bean (Phaseolus vul- garis). J Food Biochem 1984; 1:385-401. 16. Gibbs B, Alli I. Characterization of a purified...

Ngày tải lên: 31/10/2012, 15:12

8 742 1
Formatting a Pivot Table

Formatting a Pivot Table

... Conditional Formatting: Changing the Data Range Problem In your pivot table, Date is in the Row Labels area, Territory is in the Column Labels area, and Sales is in the Values area. You applied Above ... layout, the formatting is retained and adjusts to the new layout. CHAPTER 4 ■ FORMATTING A PIVOT TABLE72 Solution You can use conditional formatting icon sets to illustrate the data. These small pictures ... applied Above Average conditional formatting to the Values cells, and it is working as expected. The sales manager has asked for a last-minute change to the pivot table layout, and he would like...

Ngày tải lên: 09/10/2013, 12:20

30 380 0
Unit 8 Out and About A 1 -A 3

Unit 8 Out and About A 1 -A 3

... his car 1 Listen and read. We are walking to school They are walking to school We are travelling to school by bus We are waiting for a train They are waiting for a train They are travelling ... start 1234 5 6 78 9 10 What are you doing? I am playing video games c.What is he doing? 3 Answer then write. He is driving his car d.What are they doing? 3 Answer then write. They are waiting for a train ... Listen and read. What is he doing? He is riding his bike Ask and answer. Ride (v) :Ñi/cöôõi (xe a p,xe maùy) b.What is she doing? c.What is he doing? a. What are you doing? d.What are...

Ngày tải lên: 23/10/2013, 08:11

46 477 0
A general framework for studying class consciousness and class formation

A general framework for studying class consciousness and class formation

... framework 10. A general framework for studying class consciousness and class formation In one way or another, most class analysts believe that at the core of class analysis is a relatively simple causal ... and class formation, but rather as a framework for de®ning an agenda of problems for empirical research within class analysis. In the multivariate empirical studies of class conscious- ness and ... of analysis, typically an entire society. To say that someone is ``in'' a managerial class location is to claim that they are embedded in a set of interindividual interactions (relations)...

Ngày tải lên: 01/11/2013, 07:20

31 503 0
How to get out of the friendzone: turn your  friendship into a  relationship

How to get out of the friendzone: turn your friendship into a relationship

... he met Cara at his coed dodgeball tournament. She was pretty and nice and seemed to like him back. They started dating and things were going well. At a party soon after Sam and Cara started seeing ... seeing each other, Sam ran into Katie, who threw her arms around him and whispered that they needed to talk; she’d heard he was dating someone and wanted to know all about it. After hearing about ... environment. James and Tiana both started at an insurance company on the same day two years ago. There were five other newbies who started with them, but they all seemed kind of vanilla, so James and Tiana...

Ngày tải lên: 10/02/2014, 18:17

240 1,1K 1
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... deletion in Saccharomyces cerevisiae. Nucleic Acids Res 21 , 3329–3330. 45 Ito H, Fukuda Y, Murata K & Kimura A (1983) Transformation of intact yeast cells treated with alkali cations. J Bacteriol ... because of the absence of the catalytic subunit ISP (Table 1). Figure 3A shows that a band of approximately 500 kDa was also found in this mutant strain when the mitochondrial membranes were ana- lyzed ... c oxidase complex was clearly demonstrated [10–12], but also in other organisms, such as Neurospora crassa [13], mammals [11] and plants [14]. A higher-order organization of the respiratory chain...

Ngày tải lên: 18/02/2014, 08:20

15 641 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

... spectrum of acid-dena- tured cytochrome c (spectrum a of Fig. 8A) displays an absorption maximum around 395 nm in the Soret region, and a maximum at 497 nm, a shoulder at 528 nm and a charge transfer ... from Sigma (St Louis, MO, USA) and used without further puri- fication. High-purity guanidine-HCl was obtained from ICN (Costa Mesa, CA, USA). All the reagents used were of analytical grade. Construction ... wavelength and at a given time interval, A ¥ is the absorbance at longer time intervals (when the reaction is completed), DA i is the absor- bance change for phase I, k i is the rate constant for phase I,...

Ngày tải lên: 19/02/2014, 05:20

11 487 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

... kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (c, 250 kDa) were loaded on to a separate gradient as molecular mass markers. Novel aggregate formation of an alkaline phosphatase frame-shift ... 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (250 kDa) were loaded on to a separate gradient as mole- cular mass markers. K. Komaru et al. Novel aggregate formation of an alkaline ... Michigami T, Yamamoto T, Yasui N, Satomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada S & Ozono K (1998) Analysis of localization of mutated tissue-nonspecific alkaline phosphatase...

Ngày tải lên: 19/02/2014, 17:20

14 446 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... L. lactis ald gene as follows. A PCR fragment was generated using primer CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified. The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned ... TP901-1 phage attachment site. PCR products upstream to pyk using primer pyk1 (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk...

Ngày tải lên: 19/02/2014, 17:20

12 620 0
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

... for a phage l integrase mutant was set as 100%. In each case, data were collected from six separate transfection assays, each employing two wells containing about 2 Â 10 5 cells. (C) Normalized b-Gal ... order to inactivate the TRE-CMV promoter, doxycyclin (20 ng : mL 21 ) was added 2 weeks prior to electroporation. b-Galactosidase (b-gal) assays, Southern blotting and PCR b-Gal assays and Southern ... [14]. Strand exchange is catalyzed by dimers bound at paired sites I, while those bound at sites II and III serve accessory roles in synaptosome formation and in the activation of strand cleavage...

Ngày tải lên: 22/02/2014, 07:20

7 474 0
Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx

Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx

... and 127 of the Neurospora crassa chorismate synthase with alanine, producing two single-mutant proteins (Ser16Ala and Ser127Ala) and a double-mutant protein (Ser16Ala- Ser127Ala). The residual ... substantial decrease in activity beyond the detection limit of our assay. In contrast to the single-mutant proteins (Ser16Ala and Ser127Ala) the Ser16AlaSer127Ala dou- ble-mutant protein was not able ... Ser127Ala mutant proteins or 12.5 lm of the Ser16Ala and Ser16AlaSer127Ala mutant proteins). Chorismate formation was monitored at 275 nm under anaerobic conditions. For determination of the decay...

Ngày tải lên: 07/03/2014, 05:20

10 401 0
Báo cáo khoa học: "Generating Usable Formats for Metadata and Annotations in a Large Meeting Corpus" pptx

Báo cáo khoa học: "Generating Usable Formats for Metadata and Annotations in a Large Meeting Corpus" pptx

... order to generate tabular files (TSV) and a table-creation script. 4. Create and populate metadata tables within database. 5. Adapt the XSLT stylesheet as needed for vari- ous table formats. 5 Results: ... NLP and XML at ACL 2004), pages 9–16, Barcelona. 96 4 Metadata: Generation of Explicit Files and Conversion to Tabular Format As mentioned in Section 2, metadata denotes here any static information ... metadata and annotations. The annotation files are converted to a tabular format using an eas- ily adaptable XSLT-based mechanism, and their consistency is verified in the process. Metadata files are...

Ngày tải lên: 08/03/2014, 02:21

4 379 0
Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc

Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc

... used as standards, showed elution peaks at 4.70, 2.30 and 2.50 min, respectively (Fig. 2). In both porcine and human assays using preg as a substrate, an additional peak of elution appeared at 15 ... T., Nagata, K., Yamazoe, Y., Kato, R., Matsunaga, E., Gelboin, H.V. & Gonzalez, F.J. (1990) Cytochrome b5potentia- tion of cytochrome P-450 catalytic activity demonstrated by a vaccinia virus-mediated ... work has been supported by a grant from the Canadian Institutes of Health Research. The authors would like to thank Guy Reimnitz, Nathalie Paquet and Mei Wang for their technical assistance and...

Ngày tải lên: 08/03/2014, 08:20

7 613 0
Báo cáo khoa học: a-Fetoprotein positively regulates cytochrome c-mediated caspase activation and apoptosome complex formation docx

Báo cáo khoa học: a-Fetoprotein positively regulates cytochrome c-mediated caspase activation and apoptosome complex formation docx

... initiatory caspase 8 and caspase 1 [21]. Although these studies have shown that a caspase cascade is initiated during AFP- induced apoptosis, the mechanisms by which AFP triggers caspase activation are ... caspase 3, producing similar 52-kDa and 35-kDa fragments. Our data allow us to suggest that AFP may negatively regulate fragmentation of cIAP-2, thus modulating its antiapoptotic activity. Alternatively, AFP ... in a cell-free system in the absence of procaspase 9. AFP cannot induce activation of procaspase 9 in the absence of caspase 3 As AFP was unable to activate procaspase 3 in the absence of procaspase...

Ngày tải lên: 08/03/2014, 08:20

12 402 0

Bạn có muốn tìm thêm với từ khóa:

w