... scheme and load variables much as the operator of a plant observes the behaviour of an actual plant Dynamic simulation allows for the comparison of several candidate control strategies and assesses ... be traced back as far as the early third century BC [1] During this period, Ktesibios of Alexandria employed a float valve similar to the one found in today’s automobile carburettors to regulate ... that makes it easy to use and learn, yet still be applicable to a broad range of applications and users The criteria include the following: r Easy to use and learn It must have an intuitive and...
Ngày tải lên: 01/01/2014, 17:44
... the great men of his time Among those friends was Lord Chatham It was twenty years after Allen's death that Palmer's Mail Coach system was started Its advantage soon made itself apparent, and the ... PALMER AT THE AGE OF 75 CHAPTER V [Pg 45] APPRECIATIONS OF RALPH ALLEN, JOHN PALMER, AND SIR FRANCIS FREELING, MAIL AND COACH ADMINISTRATORS On the 25th April, 1901, the day after a visit to Bristol ... John Palmer was lessee and manager of the Bath and Bristol theatres, and went about beating up actors, actresses, and companies in postchaises, and he thought letters should be carried at the same...
Ngày tải lên: 17/02/2014, 02:20
Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx
... stewed tomatoes and unsalted tomato sauce, garlic, basil, and oregano to a saucepan (use a potato masher to mash up stewed tomatoes in the pan) Let simmer Brown the chopped meat and strain any fat, ... min) Add vegetables back to heat Eat plain or over salad to make a great fajita salad Or serve in corn tortillas made with only corn, lime, and water Another variation:serve with tomatoes, guacamole, ... Salads and Salad Dressings 18 Mixed Green Salad with Strawberry Dressing 18 Black Bean Salad 18 Egg Salad 18 Bavarian Potato Salad 19 Greens with Vinaigrette 19 Orzo Salad 19 Pasta and Pea Salad...
Ngày tải lên: 22/03/2014, 16:21
7 Steps to a Pain-Free Life: How to Rapidly Relieve Back and Neck Pain docx
Ngày tải lên: 23/03/2014, 01:20
Báo cáo khoa học: RIP1 comes back to life as a cell death regulator in TNFR1 signaling docx
... cells to necrosis mediated by tumor necrosis factor J Exp Med 187, 1477–1485 62 Sasazuki T, Okazaki T, Tada K, Sakon-Komazawa S, Katano M, Tanaka M, Yagita H, Okumura K, Tominaga N, Hayashizaki ... Schmidt-Supprian M, Ma A, Ogawa M & Sasakawa C (2010) A bacterial E3 ubiquitin ligase IpaH9.8 targets NEMO ⁄ IKKgamma to dampen the host NF-kappaB-mediated inflammatory response Nat Cell Biol 12, ... early after receptor ligation whereas the cell death regulators FAS-associated via death domain (FADD) and caspase are recruited to a pro-apoptotic complex that forms slowly in the cytoplasm This...
Ngày tải lên: 28/03/2014, 23:20
labor market transitions of involuntary part-time workers how hard is it to get back to full-time jobs
... involuntary part -time work into full -time jobs Central cities and non-metro areas have different characteristics than each other and than suburban areas in terms of available job opportunities, characteristics ... The data section describes the rural-urban as follows: Urban is composed of census metropolitan areas and agglomerations (CMA/CA) containing large urban areas, together with adjacent urban and ... to work part -time) and disadvantages (e.g., relative lack of availability of health and retirement plans to part -time workers and the receipt of lower wages) of part -time employment In contrast,...
Ngày tải lên: 03/06/2014, 02:05
do you really need back surgery a surgeons guide to neck and back pain and how to choose your treatment jul 2004
... York Auckland Bangkok Buenos Aires Cape Town Chennai Dar es Salaam Delhi Hong Kong Istanbul Karachi Kolkata Kuala Lumpur Madrid Melbourne Mexico City Mumbai Nairobi Saõ Paulo Shanghai Taipei Tokyo ... relief They are also called nonsteroidal anti-inflammatories, abbreviated as NSAIDs, to distinguish them from the steroidal anti-inflammatory medications The prototypical anti-inflammatory, and the ... pain medications are not available on a standard basis at a drug store but can be specially formulated as compounded medications Many of these are for topical use (applied to the skin) and may...
Ngày tải lên: 11/06/2014, 10:33
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx
... CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 ... 5'-TCTGAATATGTCACATCCGTTCATA-3' 5'-GGCCCGGAAAATGAGTAACA-3' 5'-(6-FAM)-TGATCTGTAGTCCCCATGTGTCC-(BHQ-1)-3' Exon OSM Exon OSM Exon OSM 5'-CCTCGGGCTCAGGAACAAC-3' 5'-GGCCTTCGTGGGCTCAG-3' 5'-(6-FAM)-TACTGCATGGCCCAGCTGCTGGACAA-(BHQ-1)-3' ... A TGATCTGTAGTCCCCATGTGTCC T T A RV1 RFHVMm RFHVMn KSHV C A T CACA T.G GAGA C T GA GG.GCCCAATT AC GT C.C.GCGG.G.TATTT AG.CAGGCT A T CACA G GAGA C T GACGGAT CCTGGT GCGCGTAA.C A...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " A general solution to the continuous-time estimation problem under widely linear processing" pdf
... than that studied in the present paper Finally, a remarkable advantage of the proposed estimator appears when ξ(t) is a real process, and x(t) is Martínez-Rodríguez et al EURASIP Journal on Advances ... classical communication example addressed in [28] and [29] Assume that a real waveform s1(t) is transmitted over a channel that rotates it by a standard normal phase θ and adds a nonwhite noise ... interval of the real line As noted above, this formulation is very general and contains as particular cases a great number of classical estimation problems, such as estimation of signals in additive...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: "Clinically important improvement in the WOMAC and predictor factors for response to non-specific non-steroidal anti-inflammatory drugs in osteoarthritic patients: a prospective study" docx
... fadouaallali@yahoo.fr Latifa Tahiri,Aff1 Email: latifatahiri@yahoo.fr Hamza Khazzani,Aff1 Email: hamzakhazzani@yahoo.fr Leila El Mansouri,Aff1 Email: la_mansouri1@yahoo.fr Sanae Ali Ou Alla,Aff1 ... Alla,Aff1 Email: sanae.alioualla@yahoo.fr Redouane Abouqal,Aff2 Email: abouqal@invivo.edu Najia Hajjaj-Hassouni,Aff1 Aff2 Email: n.hajjaj@medramo.ac.ma Aff1 Laboratory of Information and Research on ... on a visual analogy scale (VAS) as assessed by the patient) that was judged by the investigator to require treatment with an anti-inflammatory agent to control arthritis symptoms; and had a Functional...
Ngày tải lên: 21/06/2014, 19:20
Báo cáo hóa học: "EXISTENCE AND NONEXISTENCE OF POSITIVE SOLUTIONS TO A RIGHT-FOCAL BOUNDARY VALUE PROBLEM ON TIME SCALES" pptx
... Equations and Applications (2000), no 2, 165–191 Ilkay Yaslan Karaca [9] [10] [11] [12] [13] [14] 13 , Positive solutions for a nonlinear differential equation on a measure chain, Mathematical and ... boundary conditions, Journal of Computational and Applied Mathematics 132 (2001), no 2, 341–356 Ilkay Yaslan Karaca: Department of Mathematics, Ege University, 35100 Bornova, Izmir, Turkey E-mail ... hypotheses (H1) and (H2), the operator Ψnλ is a compact operator such that Ψnλ (ᏼ) ⊂ ᏼ Proof That Ψnλ is a compact operator follows by Arzela-Ascoli’s theorem Next, for all x ∈ ᏼ, by (H1), (H2), and the...
Ngày tải lên: 22/06/2014, 22:20
ROTHE TIME-DISCRETIZATION METHOD APPLIED TO A QUASILINEAR WAVE EQUATION SUBJECT TO INTEGRAL pdf
... Centre Universitaire Larbi Ben M’hidi, e e Oum El Bouaghi 04000, Algeria E-mail address: af bouziani@hotmail.com Nabil Merazga: D´ partement de Math´ matiques, Centre Universitaire Larbi Ben M’hidi, ... with an integral condition for parabolic equations with a Bessel operator, Differ Uravn 27 (1991), no 12, 2094–2098 (Russian) A Bouziani, Mixed problem with integral condition for certain partial ... diffusion equation, Abstr Appl Anal 2003 (2003), no 16, 899–922 C V Pao, Dynamics of reaction-diffusion equations with nonlocal boundary conditions, Quart Appl Math 53 (1995), no 1, 173–186 , Asymptotic...
Ngày tải lên: 23/06/2014, 00:20
Anh văn lớp 7 - Unit one: Back to school A. Friends ( A1 + A3 ) docx
... class 7a What’s the new girl’s name? Nam is also in class 7a What class is she in? 3, Practice Listen and repeat Look at the books Who is also in class 7a? (15’) Tells the students to look at ... the tape Asks the students to look at the books and listen to the tape again Work in the small groups Let’s them work in the small groups students stand up and practice Calls some groups to practice ... the dialogue Explains the different between two sentences Nice to see you and Nice to see you again ( can replace see by meet) Answer the questions Opens the tape again Her name is Hoa Makes questions:...
Ngày tải lên: 03/07/2014, 16:21
A new material to reduces curing time and improve curing reproducibility of lead–acid batteries doc
... negative plates - increases the initial capacity of industrial batteries - increases the cold-cranking amperes, reserve capacity and 20 h rate capacity of automotive batteries - maintains capacity ... determine the phases present using a Rigaku Miniflex X-ray analyzer with software adapted for calculation A summary of the data obtained from trials carried out with two automotive battery manufacturers ... is also essential for all crystals to be converted to active material at the same rate and thus ensure that plates are reproducible Wide variations in crystal size can cause signif- Fig Scanning...
Ngày tải lên: 05/07/2014, 20:21
Giáo án Anh văn lớp 7 : Tên bài dạy : UNIT ONE : BACK TO SCHOOL Lesson 2 : A. Friends (3-5). pps
... Teaching process 1.Class organization: 2.Oral test: -2 pairs of students make dialogues,using the cues: a Hello/nice/meet/too b b.Hi/pleased/see/ again/too c morning /glad/ meet/new classmate/Hoa ... How are you today? + How about you ? +Just fine + Not bad + So am I + Me too - Ss: roleplay the completed dialogues in pairs - T: calls on some pairs to read the dialogues in front of the class ... some Ss to give the answers - T: plays the tape again and asks them to check their answers - T: corrects and gives correct answers 1-c 2-b 3- d 4 -a * Post - listening - T: asks Ss to base on...
Ngày tải lên: 06/08/2014, 16:20
Giáo án Anh văn lớp 7 : Tên bài dạy : UNIT ONE : BACK TO SCHOOL. Lesson 1 : A- Friends (1-2). pps
... Slap the board T: reads the questions => Ss slap the answers Goodbye a What’s your name? b How are you today? Yes, I am c What class are you in? d Goodbye My name is Hoa Very well, thanks e Are ... T: calls on some pairs to ask and asnwer the questions in front of the class - T: corrects then gives the correct answers Keys: a. Her name is Hoa b.She is in class 7A c.Nam is also inclass 7A *Production: ... again, then work in pairs - T: calls on some pairs to ask and answer in front of the class - T: corrects and gives the correct answers a She is from Hue b She is staying with her uncle and aunt...
Ngày tải lên: 06/08/2014, 16:20
Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc
... Henares, Coslada, Madrid, Spain 3BAP Health Outcomes Research, Oviedo, Spain 4Value Demonstration Unit, AstraZeneca Medical Department, Madrid, Spain 5Neuroscience Area, AstraZeneca Medical Department, ... 178:510-517 Page of 20 Colom F, Vieta E, Martínez-Arán A, Garcia-Garcia M, Reinares M, Torrent C, Goikolea JM, Banús S, Salamero M: Spanish version of a scale for the assessment of mania: validity and ... was also examined by computing the intraclass correlation coefficient (ICC) Statistical analysis The sample size was calculated taking into account a specific objective of calculating multiattribute...
Ngày tải lên: 09/08/2014, 01:21