fixed expressions and idioms in english a corpusbased approach

DSpace at VNU: Nóng, ấm, mát and lạnh in Vietnamese and hot, warm, cool and cold in English: A Comparative Study

DSpace at VNU: Nóng, ấm, mát and lạnh in Vietnamese and hot, warm, cool and cold in English: A Comparative Study

... Philippines, has only two basic adjectives of temperature magninow and mainit in which magninow covers the area of the meanings of cold and cool and mainit, the area of the meanings of warm and ... noted that the sequence of nóng, ấm, mát, and lạnh in Vietnamese and that of hot, warm, cool, and cold in English as indicated in the title and in Sections and above are arbitrarily made In reality, ... mát, and lạnh in Vietnamese and hot, warm, cool, and cold in English occur reveal that ấm/warm and mát/cool typically have agreeable connotation whereas nóng/hot and lạnh/cold typically have disagreeable

Ngày tải lên: 14/12/2017, 21:18

11 159 0
The impacts of monetary policy on output growth and inflation in vietnam a var approach  (luận văn thạc sĩ)

The impacts of monetary policy on output growth and inflation in vietnam a var approach (luận văn thạc sĩ)

... urban area, rural area and all over of Vietnam), interest rate (lending rate), credit and exchange rate The result suggests that money supply have impact on real output growth and inflation in ... inflation in the urban area, the rural area and all over of Vietnam but the impacts are at low percentage The fact that the thesis cannot find out any channel having the impact on the real output growth, ... of Trade Statistics IFS: International Finance Statistics IMF: International Monetary Fund OECD.Stat: Organisation for Economic Co-operation and Development StatExtracts AD-AS model: Aggregate

Ngày tải lên: 12/08/2017, 21:11

104 396 0
The impacts of monetary policy on output growth and inflation in Vietnam: A var approach

The impacts of monetary policy on output growth and inflation in Vietnam: A var approach

... urban area, rural area and all over of Vietnam), interest rate (lending rate), credit and exchange rate The result suggests that money supply have impact on real output growth and inflation in ... inflation in the urban area, the rural area and all over of Vietnam but the impacts are at low percentage The fact that the thesis cannot find out any channel having the impact on the real output growth, ... of Trade Statistics IFS: International Finance Statistics IMF: International Monetary Fund OECD.Stat: Organisation for Economic Co-operation and Development StatExtracts AD-AS model: Aggregate

Ngày tải lên: 01/09/2020, 13:04

104 29 0
The impacts of monetary policy on output growth and inflation in vietnam, a var approach

The impacts of monetary policy on output growth and inflation in vietnam, a var approach

... on real output growth and inflation in the urban area, the rural area and all over of Vietnam but the impacts are at low percentage The fact that the thesis cannot find out any channel having ... VIETNAM- NETHERLANDS PROGRAMME FOR M .A IN DEVELOPMENT ECONOMICS THE IMPACTS OF MONETARY POLICY ON OUTPUT GROWTH AND INFLATION IN VIETNAM: A VAR APPROACH A thesis submitted in partial fulfilment ... of data Table 4.2: Stationary tests for variables in level Table 4.3: Stationary tests for variables in percentage change Table 4.4: Granger causality Wald tests for the basic model with Real

Ngày tải lên: 16/09/2020, 20:16

125 34 0
The impacts of monetary policy on output growth and inflation in vietnam, a var approach

The impacts of monetary policy on output growth and inflation in vietnam, a var approach

... urban area, rural area and all over of Vietnam), interest rate (lending rate), credit and exchange rate The result suggests that money supply have impact on real output growth and inflation in ... inflation in the urban area, the rural area and all over of Vietnam but the impacts are at low percentage The fact that the thesis cannot find out any channel having the impact on the real output growth, ... of Trade Statistics IFS: International Finance Statistics IMF: International Monetary Fund OECD.Stat: Organisation for Economic Co-operation and Development StatExtracts AD-AS model: Aggregate

Ngày tải lên: 17/09/2020, 20:43

104 34 0
(Luận văn thạc sĩ) the impacts of monetary policy on output growth and inflation in vietnam a var approach

(Luận văn thạc sĩ) the impacts of monetary policy on output growth and inflation in vietnam a var approach

... urban area, rural area and all over of Vietnam), interest rate (lending rate), credit and exchange rate The result suggests that money supply have impact on real output growth and inflation in ... inflation in the urban area, the rural area and all over of Vietnam but the impacts are at low percentage The fact that the thesis cannot find out any channel having the impact on the real output growth, ... of Trade Statistics IFS: International Finance Statistics IMF: International Monetary Fund OECD.Stat: Organisation for Economic Co-operation and Development StatExtracts AD-AS model: Aggregate

Ngày tải lên: 31/12/2020, 11:08

104 23 0
(LUẬN văn THẠC sĩ) the impacts of monetary policy on output growth and inflation in vietnam, a var approach

(LUẬN văn THẠC sĩ) the impacts of monetary policy on output growth and inflation in vietnam, a var approach

... urban area, rural area and all over of Vietnam), interest rate (lending rate), credit and exchange rate The result suggests that money supply have impact on real output growth and inflation in ... inflation in the urban area, the rural area and all over of Vietnam but the impacts are at low percentage The fact that the thesis cannot find out any channel having the impact on the real output growth, ... LIST OF TABLE Table 4.1: Summary of data Table 4.2: Stationary tests for variables in level Table 4.3: Stationary tests for variables in percentage change Table 4.4: Granger causality Wald tests

Ngày tải lên: 15/07/2022, 20:31

104 8 0
The impacts of monetary policy on output growth and inflation in vietnam a var approach

The impacts of monetary policy on output growth and inflation in vietnam a var approach

... urban area, rural area and all over of Vietnam), interest rate (lending rate), credit and exchange rate The result suggests that money supply have impact on real output growth and inflation in ... inflation in the urban area, the rural area and all over of Vietnam but the impacts are at low percentage The fact that the thesis cannot find out any channel having the impact on the real output growth, ... ICOR: Incremental Capital-Output Ratio DOT: Direction of Trade Statistics IFS: International Finance Statistics IMF: International Monetary Fund OECD.Stat: Organisation for Economic Co-operation and

Ngày tải lên: 11/10/2022, 23:00

135 5 0
(Luận văn) the impacts of monetary policy on output growth and inflation in vietnam, a var approach

(Luận văn) the impacts of monetary policy on output growth and inflation in vietnam, a var approach

... and n inflation in the urban area, the rural area and all over of Vietnam but the impacts are va at low percentage The fact that the thesis cannot find out any channel having the n ll fu impact ... urban area, rural area yi and all over of Vietnam), interest rate (lending rate), credit and exchange rate pl ua al The result suggests that money supply have impact on real output growth and ... TABLE t to ng hi Summary of data Table 4.2: Stationary tests for variables in level ep Table 4.1: Table 4.3: Stationary tests for variables in percentage change w n lo Table 4.4: Granger causality

Ngày tải lên: 28/07/2023, 16:20

104 5 0
(Luận văn thạc sĩ) the impacts of monetary policy on output growth and inflation in vietnam, a var approach

(Luận văn thạc sĩ) the impacts of monetary policy on output growth and inflation in vietnam, a var approach

... urban area, rural area and all over of Vietnam), interest rate (lending rate), credit and exchange rate The result suggests that money supply have impact on real output growth and inflation in ... inflation in the urban area, the rural area and all over of Vietnam but the impacts are at low percentage The fact that the thesis cannot find out any channel having the impact on the real output growth, ... of Trade Statistics IFS: International Finance Statistics IMF: International Monetary Fund OECD.Stat: Organisation for Economic Co-operation and Development h GDP: StatExtracts AD-AS model: Aggregate

Ngày tải lên: 14/11/2023, 06:13

104 8 0
ENGAGING VIETNAMESE YOUNG LEARNERS IN MATHEMATICS IN ENGLISH: A MULTISEMIOTIC APPROACH - Full 10 điểm

ENGAGING VIETNAMESE YOUNG LEARNERS IN MATHEMATICS IN ENGLISH: A MULTISEMIOTIC APPROACH - Full 10 điểm

... theoretical frameworks for mathematical symbolism and visual display As reviewed in O‟Halloran‟s (2004, pp 13-15) the multisemiotic approach, where language, visual images and mathematical symbolism are ... essentially a new approach to mathematics for teachers and students of mathematics, offering penetrating insights into the functions of the semiotic resources, individually and integrally Overall, although ... these materials can enhance incidental vocabulary learning Two major areas of interest are the lexis specific to the field of Mathematics and that to children‟s everyday world MATHEMATICAL DISCOURSE

Ngày tải lên: 27/02/2024, 21:22

10 4 0
A cross cultural study on idiomatic expressions containing numbers in english and vietnamese

A cross cultural study on idiomatic expressions containing numbers in english and vietnamese

... and again - Pairs of verbs: chop and change, sink or swim, live and learn - Identical pairs:... of meaning and grammar We will have a look at the certain situation to understand clearly ... and the meanings of idioms containing numbers in English and Vietnamese cultures can be established and made clear According... language and culture is inseparable, numerical ... life and have certain cultural characteristics also appear in idioms. Idiomatic expressions containing numbers bring about interesting diverse meanings to our utterances and writings. Personally,

Ngày tải lên: 17/07/2015, 10:57

85 956 2
A STUDY OF SYNTACTIC AND SEMANTIC FEATURES OF ENGLISH EXPRESSIONS OF EXISTENCE IN ENGLISH WITH REFERENCE TO THEIR VIETNAMESE EQUIVALENTS

A STUDY OF SYNTACTIC AND SEMANTIC FEATURES OF ENGLISH EXPRESSIONS OF EXISTENCE IN ENGLISH WITH REFERENCE TO THEIR VIETNAMESE EQUIVALENTS

... life and country life differ in many ways) 4.3Suggestions for teaching, learning and translating expressions of existence in English for Lao Cai teacher training college learners Practicing a lot ... in translating sentences containing expressions of existence in English Successful translation is measured by three criteria: accurate, natural and communicative A form in one language may have ... The data analysis may show that not only students at Lao Cai Teacher Training College in particular but also Vietnamese studentsin general may make errors in using expressions of existence in English

Ngày tải lên: 17/01/2019, 22:47

66 239 1
A cognitive study of lexical expressions denoting motion in english and vietnamese tt tiếng anbh

A cognitive study of lexical expressions denoting motion in english and vietnamese tt tiếng anbh

... Language approach Lucy (1997) proposes the structure-centered approach standing for a language approach which begins with an analysis of language structure and then moves to an operational characterization ... the caused motion construction which aims at explicating the single-clause causation expressions in English and double-clause causation expressions in Vietnamese a Single - clause causation expressions ... dictionaries and (ii) English and Vietnamese stories and novels in the 20th century onward 3.6.1 Analytical framework The dissertation was investigated under the two analytical frameworks, which are Talmy’s

Ngày tải lên: 21/02/2020, 07:10

27 56 0
A cognitive study of lexical expressions denoting motion in english and vietnamese tt

A cognitive study of lexical expressions denoting motion in english and vietnamese tt

... LIỆU ĐÃ CÔNG BỐ Ly Ngoc Toan, (2019): Lexical Expressions of Path Motion in Vietnamese: A Perspective from Cognitive Linguistics International journal of language and literary studies Vol 1, Issue ... Toan, (2018): The Lexicalization Patterns of Manner Motion Events in Vietnamese Journal of English Linguistics Research Vol 7, No 4; 2018 Ly Ngoc Toan (2019): A Cognitive Study on Lexical Expressions ... External V % a Motion +Path Total b Motion + Path + Manner c Motion + Path + Ground 23 23 12 60.5 60.5 31.5 7.8 Total d Motion + Path+ Ground+ Manner 15 39.5 0 38 100 External External Lexicalization

Ngày tải lên: 21/02/2020, 07:10

27 80 0
A cognitive study of lexical expressions denoting motion in english and vietnamese

A cognitive study of lexical expressions denoting motion in english and vietnamese

... teaching and learning, linguistic research and translation One of the results found in the dissertation will have practical implication for each domain iii LIST OF ABBRREVIATIONS Arg AS C Argument ... Vietnamese in terms of semantic and syntactic properties Concerning data analysis, the study draws on some main methods to collect as well as analyze the data, namely deductive and inductive, quantitative ... structures In doing so, the dissertation aims to establish several frameworks to analyze the semantics and syntax of LEsM and to elicit the similarities and differences in LEsM between English and Vietnamese

Ngày tải lên: 21/02/2020, 07:24

258 47 1
A cognitive study of lexical expressions denoting motion in english and vietnamese

A cognitive study of lexical expressions denoting motion in english and vietnamese

... teaching and learning, linguistic research and translation One of the results found in the dissertation will have practical implication for each domain iii LIST OF ABBRREVIATIONS Arg AS C Argument ... Vietnamese in terms of semantic and syntactic properties Concerning data analysis, the study draws on some main methods to collect as well as analyze the data, namely deductive and inductive, quantitative ... structures In doing so, the dissertation aims to establish several frameworks to analyze the semantics and syntax of LEsM and to elicit the similarities and differences in LEsM between English and Vietnamese

Ngày tải lên: 24/02/2020, 19:00

258 52 0
A cognitive study of lexical expressions denoting motion in english and vietnamese

A cognitive study of lexical expressions denoting motion in english and vietnamese

... teaching and learning, linguistic research and translation One of the results found in the dissertation will have practical implication for each domain iii LIST OF ABBRREVIATIONS Arg Argument AS ... Triangle of methodological approaches in cognitive linguistics 37 Figure 3.2 Stages in language approach 38 Figure 3.3 Stages in cognition approach 39 Figure 3.4 Stages in usage-based approach ... Vietnamese in terms of semantic and syntactic properties Concerning data analysis, the study draws on some main methods to collect as well as analyze the data, namely deductive and inductive, quantitative

Ngày tải lên: 24/02/2020, 20:30

250 60 0
Báo cáo y học: " Involvement of HTLV-I Tax and CREB in aneuploidy: a bioinformatics approach" pot

Báo cáo y học: " Involvement of HTLV-I Tax and CREB in aneuploidy: a bioinformatics approach" pot

... H, Tanaka Y, Tamada M, Hu CD, Yamawaki-Kataoka Y, Kariya K, Kataoka T: Association of yeast adenylyl cyclase with cyclase-associated protein CAP forms a second Ras-binding site which mediates ... 18:3620-3632. 40. Iwanaga Y, Tsukahara T, Ohashi T, Tanaka Y, Arai M, Nakamura M, Ohtani K, Koya Y, Kannagi M, Yamamoto N, Fujii M: Human T-cell leukemia virus type 1 tax protein abrogates interleukin-2 dependence ... Yes NM_009503 p97(Vcp) ATTGCCTTTGTCGATTGGTC TCGGAAGGAAAGCTGCTCTA 228 Yes BC046832 Ppp1cb AGCAGGGAAGGAAGGTCATT GGCGTTCTCACCTACGAGTC 529 Yes AJ534939 Smc2l1 CTTACAGCCGTTTGCCTAGC CCGTTTTGAACATGGAAAGC 439 Yes BC009167 Sgt1...

Ngày tải lên: 13/08/2014, 09:20

21 531 0
w