finding datafiles and archivelogs that need a backup

Procedural Abstraction and Functions That Return a Value

Procedural Abstraction and Functions That Return a Value

... parameter names may or may not match variable names used in the main part of the program  It does not matter if formal parameter names match other variable names in the program  Remember that only ... the formal parameter names  Formal parameters are like placeholders for the actual arguments used when the function is called  Formal parameter names can be any valid identifier Example: double ... Publishing as Pearson Addison-Wesley Slide 4- 38 Buying Pizza Function Analysis  Subtask and subtask should be implemented as a single function because  Subtask and subtask are identical tasks ...

Ngày tải lên: 12/09/2012, 22:48

94 542 0
Tài liệu Finding, Filtering, and Sorting Rows in a DataTable ppt

Tài liệu Finding, Filtering, and Sorting Rows in a DataTable ppt

... Quantity " + "FROM [Order Details] " + "ORDER BY OrderID"; SqlDataAdapter mySqlDataAdapter = new SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; DataSet myDataSet = new DataSet(); ... PrimaryKey property for the Order Details DataTable // to the OrderID and ProductID columns DataTable orderDetailsDataTable = myDataSet.Tables["Order Details"]; orderDetailsDataTable.Constraints.Add( ... DataViewRowState.OriginalRows); foreach (DataRow myDataRow in productDataRows) { foreach (DataColumn myDataColumn in productsDataTable.Columns) { Console.WriteLine(myDataColumn + "= " + myDataRow[myDataColumn]);...

Ngày tải lên: 14/12/2013, 13:15

7 499 0
Báo cáo y học: " Association between nasal shedding and fever that influenza A (H3N2) induces in dogs" potx

Báo cáo y học: " Association between nasal shedding and fever that influenza A (H3N2) induces in dogs" potx

... experience canine influenza cases Veterinarians should segregate those Page of animals suspected of carrying influenza that show a high fever (>39.5°C) and thus may spread high viral loads by nasal shedding ... pathological information, MJY: conducted animal care and sample collection, HKK: conducted data analysis, statistical analysis and drawing the figures, SYH: conducted real time RT-PCR for CIV, DJA: participated ... to the variability of inflammatory and immune responses in CIV-infected hosts In similar study of viral shedding in human after infection of pandemic H1N1, viral load was maintained at a high...

Ngày tải lên: 11/08/2014, 21:21

4 280 0
Believe Me: Why Your Vision, Brand, and Leadership Need a Bigger Story

Believe Me: Why Your Vision, Brand, and Leadership Need a Bigger Story

... www.getstoried.com Reclaim What Was Forgotten A wise man and shopkeeper by the name Mr Bawa taught me the following story It teaches an Akan West African value and proverb that reminds us “to go back and get ... knows that she can no longer remain and accept the status quo As she travels through the unknown, she unavoidably gets lost And along the way, teachers appear and she learns new skills that build ... demonstrate that story in your own daily actions? These are the criteria of evaluation that allow people to trust and embrace your story Real leaders know that they are NOT the story Despite appearances,...

Ngày tải lên: 19/10/2013, 19:21

87 383 1
Tài liệu Báo cáo khoa học: "A Pattern Matching Method for Finding Noun and Proper Noun Translations from Noisy Parallel Corpora" doc

Tài liệu Báo cáo khoa học: "A Pattern Matching Method for Finding Noun and Proper Noun Translations from Noisy Parallel Corpora" doc

... m a n judges (El-E3) Evaluator E1 is a native Cantonese speaker, E2 a Mandarin speaker, and E3 a speaker of both languages The results are shown in Figure The average accuracy for all evaluators ... N candidate evaluation is useful because in a machine-aided translation system, we could propose a list of up to, say, ten candidate translations to help the translator We obtained the evaluations ... technique, was proposed as a good way to match these 1This was found to be the case in the Japanese translation of the AWK manual (Church et al 1993) The Japanese AWK was also found to contain different...

Ngày tải lên: 20/02/2014, 22:20

8 429 0
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

... Morphological and phenotypic characterization Physiological and biochemical parameters, such as Gram reaction, flagella type, catalase activity, oxidase activity and OF test, were determined using classical ... sucrose Alkali was produced from L-asparagine, citrate, galactarate and tartrate The nucleotide sequence (1457 bp) of the 16S rRNA gene of strain 10d was 96.7% identical with that of Bordetella avium ... REFERENCES Fujisawa, H & Hayaishi, O (1968) Protocatechuate 3,4-dioxygenase I Crystallization and characterization J Biol Chem 243, 2673–2681 Murakami, S., Nakanishi, Y., Kodama, N., Takenaka, S., Shinke,...

Ngày tải lên: 21/02/2014, 01:21

7 492 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... designed: forward 5¢-GATAAGGTACCTGCACTGACACGGATG AAAGC-3¢ and reverse 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢ b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and...

Ngày tải lên: 07/03/2014, 21:20

12 563 0
Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

... (2000) Chemical synthesis and characterization of maurocalcine, a scorpion toxin that activates Ca2+ release channel/ryanodine receptors FEBS Lett 469, 179–185 Mosbah, A. , Kharrat, R., Fajloun, Z., ... SK channels from rat brain synaptosomes Rat brain synaptosomes (P2 fraction) were prepared according to Gray and Whittaker [19] Protein content was assayed by a modified Lowry method [125I]Apamin ... using a voltage-clamp amplifier (GeneClamp 500, Axon Instruments, Foster City, CA, USA) interfaced with a 16-bit AD/DA converter (Digidata 1200 A, Axon Instruments) for acquisition and voltage protocol...

Ngày tải lên: 17/03/2014, 10:20

10 503 0
Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt

Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt

... promoter fragment The sequences of the oligonucleotides used for these experiments are: Oligo I, 5¢-CAAGGACGTTCGATGCA CTTCCAAAAAACATATAAT-3¢; Oligo II, 5¢-CAAT GTAGTATTAAAAAGTAGTAGTTAAAAGC-3¢; Oligo ... PCR reaction with AtCaM5 primers (forward primer: 5¢-GATGTTGATGGTGATGGTCA-3¢; reverse primer: 5¢-AAACCAGCCATGAATGAAAT-3¢) and with actin primers (forward primer: 5¢-GTTGGGAT GAACCAGAAGGA-3¢; ... primer: 5¢-GAACCA CCGATCCAGACACT-3¢) as a control Reactions with no DNA added served as a negative control The PCR cycling profile was: denaturation at 92 °C for 30 s, annealing at 58 °C for and extension...

Ngày tải lên: 18/03/2014, 01:20

12 367 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

... small-size NAP (s-NAP; lanes c and c¢), medium-size NAP (m-NAP; lanes d and d¢) or largesize NAP (l-NAP; lanes e and e¢) and exposed to DNase I Controls were the whole genomic DNA (lane a) and ... Saminathan M, Thomas T, Shirahata A, Pillai KS & Thomas TJ (2002) Polyamine structural effects on the induction and stabilization of liquid crystalline DNA, potential applications to DNA packaging, ... cycle, particularly the S-phase [21] Temperature is an additional factor capable of affecting DNA conformation It has been reported that (a) an increase of a few °C is associated with a reduction...

Ngày tải lên: 23/03/2014, 15:20

11 383 0
Báo cáo khoa học: Sugar and alcohol molecules provide a therapeutic strategy for the serpinopathies that cause dementia and cirrhosis pot

Báo cáo khoa học: Sugar and alcohol molecules provide a therapeutic strategy for the serpinopathies that cause dementia and cirrhosis pot

... between strands and of b-sheet A to allow partial loop insertion and a patent lower b-sheet A that can act as a receptor for the loop of another molecule and hence form polymers [42,51] This patent ... neuroserpin migrated as a single band on SDS ⁄ PAGE and > 90% was in a monomeric form when assessed by nondenaturing and transverse urea gradient PAGE [56] Purification of Z a1 -antitrypsin and refolding/incubation ... Janciauskiene S, Eriksson S, Callea F, Mallya M, Zhou A, Seyama K, Hata S & Lomas DA (2004) Differential detection of PAS-positive inclusions formed by the Z, Siiyama and Mmalton variants of a1 -antitrypsin...

Ngày tải lên: 30/03/2014, 11:20

13 495 0
Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt

Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt

... quinquestriatus hebraeus was collected from scorpion stings to a parafilm membrane Sarcophaga falculata (blowfly) larvae and Periplaneta americana (cockroaches) were bred in the laboratory Albino laboratory ... when a characteristic paralysis (transient immobilization and contraction replaced by gradually increasing flaccidity) was obtained and lasted at least 15 ED50 values were calculated as was described ... typical b-toxin binding properties to a greater extent than AahIT4 Lqhb1 and AahIT4 vary also in their effect on blowfly larvae as AahIT4 induces contraction [23] and Lqhb1 induces flaccid paralysis...

Ngày tải lên: 31/03/2014, 01:20

8 393 0
Chapter 2Communicating Over the Network Quangkien@gmail.com.OverviewDescribe the structure of a network, including the devices and media that are necessary for successful communications. Explain the function of protocols in network communications. Ex potx

Chapter 2Communicating Over the Network Quangkien@gmail.com.OverviewDescribe the structure of a network, including the devices and media that are necessary for successful communications. Explain the function of protocols in network communications. Ex potx

... The amount of data and the speed at which it must be transmitted – The cost of the media and installation 17 Local Area Network (LAN) Local Area Network (LAN) An individual network usually spans ... Frame Header IP Header Data App TCP Header Header Frame Trailer Data Message: Data Multiple protocols 26 Multiple protocols (encapsulated) HTTP Header Protocols Frame Header IP Header Data App TCP ... encapsulations Data Link Header IP Header TCP Header HTTP Header Data Data Link Trailer The receiving host receives the message with multiple decapsulations Data Link Header IP Header TCP Header...

Ngày tải lên: 01/04/2014, 12:20

52 552 0
university press of kentucky steven spielberg and philosophy were gonna need a bigger book nov 2008

university press of kentucky steven spielberg and philosophy were gonna need a bigger book nov 2008

... the bacon, and my mom cooked it, and we ate it I went to my dad with things, but he was always analytical I was more passionate in my approach to any question, and so we always clashed.”4 Arnold ... multiple cameras and from multiple angles; the duration of each shot is carefully regulated for maximum dramatic effect and so that both the scene and the film as a whole have a discernible “pace”; each ... view that innocence is intrinsically valuable If it is true that innocence is intrinsically valuable, then we may have a way to reconcile agent-neutral and agent-relative obligations—at least as...

Ngày tải lên: 11/06/2014, 12:52

284 382 0
báo cáo hóa học: " Comparison of the discriminative ability of a generic and a condition-specific OHRQoL measure in adolescents with and without normative need for orthodontic treatment" potx

báo cáo hóa học: " Comparison of the discriminative ability of a generic and a condition-specific OHRQoL measure in adolescents with and without normative need for orthodontic treatment" potx

... lip and palate as well as any craniofacial anomaly, Class II and Class III buccal occlusions, and hypodontia Only the highest scoring trait is used to assess treatment need [29] Thereafter, adolescents ... that affect dental appearance and have an impact on participants' daily lives may not be captured by IOTN In addition, DAI has many more measures of malocclusion affecting the anterior teeth than ... spacing + 3×(diastema) + largest anterior maxillary irregularity + largest anterior mandibular irregularity + 2×(anterior maxillary overjet) + 4×(anterior mandibular overjet) + 4×(vertical anterior...

Ngày tải lên: 18/06/2014, 19:20

6 595 0
software that sells a practical guide to developing and marketing your software project

software that sells a practical guide to developing and marketing your software project

... friends and relatives you will arrive at an explanation that everyone can understand Your explanation should raise few questions and most people should find it satisfactory as far as it goes Marketing ... generally take each question at face value Ask yourself what each question means literally Avoid all potentially confusing meanings Also avoid words that invariably trigger predictably unwanted ... telephone and following up via e-mail or the Web The great advantage of conducting the survey electronically is that it is faster and cheaper All the data can be posted directly into a database for...

Ngày tải lên: 06/07/2014, 15:29

380 289 0
what is clause   (A clause is a group of words that contains a subject and a finite verb)

what is clause (A clause is a group of words that contains a subject and a finite verb)

... clause Main clause (independent clause) These can stand alone because they express complete thoughts Subordinate clause (dependent clause) These can’t stand alone and need another clause to complete ... WHAT IS CLAUSE?  A c laus e  is a group of words that contains a subject and a finite verb Ex: I get slimmer and slimmer S  A c laus e V constitutes only part of a sentence Ex: ... noun, adjective, and adverb gfgghgnggggggggdis ghxhgxsjhajhabBDJ HSGDJHGDJHSDJH VXHDVHSVDHAVVS XHS Subordinate clause There are kinds of subordinate clause: noun, adjective, and adverb - An adjective...

Ngày tải lên: 13/07/2014, 23:27

8 624 0
Báo cáo y học: "Expert agreement confirms that negative changes in hand and foot radiographs are a surrogate for repair in patients with rheumatoid arthritis" pot

Báo cáo y học: "Expert agreement confirms that negative changes in hand and foot radiographs are a surrogate for repair in patients with rheumatoid arthritis" pot

... indicated that readers were able to accurately recognize a single feature or a combination of features that was interpreted as repair in many cases Assignment of the correct sequence was significantly ... whole hand/foot image and inferred assignment) ranged for all readers from 70% to 75% The percentages of cases falsely classified as having repair ranged from 1.5% to 5%, and those of cases falsely ... cases that are equivocal The analysis that excluded these cases indicates that where there is a clear-cut difference between images at two time points at intervals of months to years, the panel's...

Ngày tải lên: 09/08/2014, 10:20

9 375 0
w