... He was 37 years Trang 3old, married and he had two daughters, Vi and Mi His daughter-in-law named Thuy, wasa doctor in the maternity hospital The general’s material life was prosperous in a time ... reader can also see that things are topsy-turvy They suggest an aloneness The general’s villa is far from a rural area but it is not near a city This type of chaotic space is neither familiar ... something that is an Eastern characteristic The general had only two granddaughters and that was thought to be a tragedy His son had no sons The narrator did not explain this but, in the Eastern way of
Ngày tải lên: 25/11/2020, 23:54
... behavior (RU) Analysis Qualitative data analysis Data were analyzed within site-specific data sets and then triangulated across site-specific data sets before making comparisons across sites Analyses ... and Associates, LLC, 5747 W Drake Court, Chandler, AZ 85226, USA, 5 VA HSR&D Center for Organization, Leadership and Management Research, Boston, MA, 02130 USA and 6 Health Policy and Management ... relations, alignments, and capabilities. Managerial-clinical relations The quality of the interface between staff and management. Simplicity and clarity of goals • The ability 'to narrow the change
Ngày tải lên: 11/08/2014, 16:20
báo cáo hóa học: "Transmembrane potential induced on the internal organelle by a time-varying magnetic field: a model study" pdf
... regions, V was obtained by solving Laplace’s equation Trang 3Figure 1 The model of a spherical cell with a concentric spherical internal organelle A Relative coil and the targeted cell location, and ... values,ψcellwas always greater than andψorg(Figure 3A) At 10 kHz, the maximal polariza-tion on the cell membrane was 9.397 mV, and the maxi-mum polarization on the internal organelle was only 0.08 mV Figure ... membrane affect its own polarization? An increase in the organelle radius led to a greater ψorg (Figure 7A, left) The phase-frequency relationship differentiated at a radius value around 1.1 um Above
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Anandamide inhibits Theiler’s virus induced VCAM-1 in brain endothelial cells and reduces leukocyte transmigration in a model of blood brain barrier by activation of CB1 receptors" pdf
... VCAM-1 was measured by ELISA in supernatants of brain endothelial cells infected with TMEV and subjected to AEA and/or cannabinoid receptors antagonist treatment To evaluate the functional effect ... counting adhered leukocytes by Meta-morph software The assay was performed in triplicate for each value and was repeated 3 times Calcein acetoxy-methyl ester is a vital dye what is membrane permeable ... inflammatory and the neurodegenerative processes associated to MS and other neurodegenerative diseases [rev [10,11]] Both AEA and 2-AG possess anti-inflammatory and neuroprotective properties against
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Modulation of spinal cord synaptic activity by tumor necrosis factor alpha in a model of peripheral neuropathy" potx
... analysis In the case of amplitude analysis, the same events and data segments were used Data are expressed as means ± standard error of the mean (SEM) Some data were normalized as a percentage of the ... spinal cord synaptic activity by tumor necrosis factor alpha in a model of peripheral neuropathy Journal of Neuroinflammation 2011, 8:177 doi:10.1186/1742-2094-8-177 Diana Spicarova (dianaspicarova@biomed.cas.cz) ... display rapid activation and inactivation [31, 33] It was suggested that the increased recovery rates from inactivation of Nav 1.3 channels expressed along the axon after axotomy compared to Nav
Ngày tải lên: 19/06/2014, 22:20
Báo cáo hóa học: " Research Article A Robust Structural PGN Model for Control of Cell-Cycle Progression Stabilized by Negative Feedbacks" pdf
... with what is observed in nature Axiom (iv) means that the system has a main trajectory, that is, one that is much more probable than the others Axiom (v) means that genes act as a nonlinear gate ... that is, in time intervals Axiom (ii) imposes that all states are reachable, that is, noise may lead the system to any state It is a quite general model that reflects our lack of knowledge about ... included in the model architecture Af-ter adjusting its parameAf-ters heuristically, the model was able to represent dynamical properties of real biological systems, such as sequential propagation of
Ngày tải lên: 22/06/2014, 19:20
Modeling in MathWorks Simscape by building a model of an automatic gearbox
... be applied to other physical domains and with this came the rise of languages such as Simscape, Modelica, MapleSim and 20Sim The advantages of these tools are particularly that the mathematical ... inhämtats genom att studera relevant litteratur och genom att tala med berörda personer Det andra steget var att bekanta sig med Simscape och den fysiska modelleringsapproachen Den fysiska modelleringsapproachen ... physical domain Each energy flow is represented by its variables and each flow has two variables, one through and one across In Simscape they are called basic or conjugate variables and for example
Ngày tải lên: 24/07/2014, 09:44
Báo cáo y học: "A model for generating circadian rhythm by coupling ultradian oscillators" potx
... Reso-nating circadian clocks enhance fitness in cyanobacteria Proc Natl Acad Sci USA 1998, 95:8660-8664. 53 Dodd AN, Salathia N, Hall A, Kevei E, Toth R, Nagy F, Hibberd JM, Millar AJ, Webb AAR: ... transcriptional-transla-tional oscillators of relatively fast (ultradian) frequencies to drive a forced oscillator with a period of approximately 24 hours, i.e a circadian oscillator The ultradian oscilla-tors ... ND, Kowalik TF, Schmid RM, Huang ES, Baldwin AS, Nabel GJ: Dimerization of NF-KB2 with relA(p65) regu-lates DNA binding, transcriptional activation, and inhibition by an ikappaB-alpha (MAD-3)
Ngày tải lên: 13/08/2014, 23:20
Báo cáo y học: " Status of complete proteome analysis by mass spectrometry: SILAC labeled yeast as a model system" ppt
... our entire data set (Additional data file 1) A total of more than 200,000 MS/MS spectra were acquired and searched against the yeast proteome using a probability based program (Mascot [22]) We ... However, mRNA analysis also has a dynamic range challenge and, according to some reports, a large part of rare messages are not accurately Number of peptides identifying yeast proteins Figure 4 ... Principle advantages of additional stages of fractionation are that demands on sensitivity are decreased if proportionately more material is employed For example, about 10 times more material can be
Ngày tải lên: 14/08/2014, 16:21
Báo cáo sinh học: " Model of invasion of a population by transposable elements presenting an asymmetric effect in gametes" docx
... zygotes Table II summarizes thelist of parameters used in the model Trang 5ANALYSIS OF THE MODELAnalysis of initial element propagation conditions If we assume panmixia in an infinite population, ... mean and the variance of the tth generation is verified by computing the mean and the variance of the (t+1)th generation from the formulae that led to equations [2] and [3]. Examinations of a ... and we must take into account the way a (i, j) zygote produces new elements SIMULATION AND NUMERICAL ANALYSES Evolution simulation program To reduce the simulation program run time and have a
Ngày tải lên: 14/08/2014, 19:22
A simulation by using cohesive zone model for indentation test in thin film substrate systems
... Mulhearn’s mechanism to a cavity in an elastic-plastic material being expanded by internal pressure He found that the elastic modulus of material played a critical role in this deformation mechanism ... Barenblatt [18] who first described fracture as a process of a material separation across a surface This model appears by different names, such as cohesive process zone model, cohesive zone model, ... displacement can be called as “cohesive law” or “Traction-Separation law” When an extended is force applied to the models, the upper and lower surfaces separate gradually, after the separation
Ngày tải lên: 26/09/2015, 09:56
ESTABLISHMENT A SUBCUTANEOUS TUMOR MODEL BY HepG2 CELL LINE IN MICE TO STUDY ANTI-TUMOR EFFECT OF LIPOSOME PACLITAXEL
... MEDICINE AND PHARMACY AT HO CHI MINH CITY Faculty of Pharmacy ESTABLISHMENT A SUBCUTANEOUS TUMOR MODEL BY HepG2 CELL LINE IN MICE TO STUDY ANTI-TUMOR EFFECT OF LIPOSOME PACLITAXEL Research Team: Asso.Prof ... cases in the world - 2008, over 725.000 (Southeast Asia: 75.000 new cases) - Vietnam: high percentage of HCC patients, high cost of medications (imported) Paclitaxel: - Antiproliferation & death ... induction against human HCC (in vitro); - Combination with DOX reduced HCC tumor size (in vivo) - Poor solubility and permeability poor bioavailability - Liposomal paclitaxel: enhance solubility,
Ngày tải lên: 15/05/2018, 16:20
epigenetic regulation of histone modifications and gata6 gene expression induced by maternal diet in mouse embryoid bodies in a model of developmental programming
... ggaagacaccccaatctcg catggccccacaattgac qRT-PCR Gata6 ggtctctacagcaagatgaatgg tggcacaggacagtccaag Dab2 ccacctccacaaagtaccaaa caagcaagtcgtttgctgaa Hdac3 ctctggtgaagggtttggaa tgtccatgtctcatccctga Gapdh ... catttggagggagcgactaa tccaaggacgctagtttggt Gata6 P3 agaacctggactgcgcttt tttgctgctccctcaatgta Gata6 P5 cctggtgtcccaacacacta tggccttgaattcactccat Gapdh pmt gggttcctataaatacggactgc ctggcactgcacaagaagat Gata4 ggaagacaccccaatctcg ... Assay Gata4 P1 gggctggtggaggttctc tcagtgcctagagacgcaag ChIP Q-PCR Gata4 P3 gccattctctgcattcatcc tcgctgagcatcaaggaac Gata4 P5 tctgagaggagccgataacc gaactaggcgacctctgtgc Gata6 P1 catttggagggagcgactaa
Ngày tải lên: 02/11/2022, 09:29
Development of a conditional liver tumor model by mifepristone inducible cre recombination to control oncogenic krasv12 expression in transgenic zebrafish
... was used as a template in the secondary PCR using primers 5 ′ -A GA GG AA TT C CA CC AT GG CA CC CA AG AA GA AG AG GA AG G TG GC CA AT TTACTGACCGTA CACAAAATTTGC-3′ and 5′- CCTGCTGGAAGATGGCGATTAGCCATTAAGCTTATAGCGGCCGCAGAG-3′ ... construct, a NLS-Cre fragment was amplified by PCR from the pACN (Bunting et al., 1999) using primers 5′-AGAGGAATTCCACCATGGCCAATTTACTGACCGTACACAAAATTTGC-3′ and 5′-CCTGCTGG AAGATGGCGATTAGCCATTAA-3′ ... hepatocellular adenomas, more anaplastic foci of hepato-cellular carcinoma arising in a lower grade hepatohepato-cellular carcinoma mass, and also documented hepatoblastoma arising in mixed hepatocellular/biliary
Ngày tải lên: 24/11/2022, 17:53
An analysis of the suggested translation of chapter 2 from the book without saying a word by kasia wezowski and patryk wezowski 2018
... has seven meanings:[1]a person who flies an aircraft (usually a small one, not a passenger plane).[2]a person who travels in a plane as a passenger.[3]a person who operates something such as a ... Showcasing my translation and analysis abilities. - Enhancing my translation abilities and my ability to analyze the book's substance. - Gaining a deeper understanding of the author's ideas and ... Grammar is an integral component of a graduation paper Therefore, I studied sentence types and clauses to analyze them accurately and avoid basic mistakes when translating During the grammar analysis,
Ngày tải lên: 21/08/2023, 21:53
Building a loss given default prediction model by machine learning techniques (khóa luận tốt nghiệp Đại học)
... Panel Data Regression Model leverages panel data to estimate Loss Given Default (LGD) by capturing variations across both time and space This approach enables the analysis of factors that may ... valuable variables that enhance the model's relevance This approach ensures that the model encompasses both historical data and critical risk management factors, leading to more accurate and ... pd.DataFrame(columns=['Model', 'Dataset']) # Train and evaluate each model for model_name, model in models.items(): print(datetime.now(), model_name) # Train the model model = model.fit(X_train,
Ngày tải lên: 23/01/2025, 15:07
Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials
... wastes are medical wastes which contain factors that can harm man’s health and environment. Those factors should be easy-infectious, radioactive, inflammable, etc. 1.2. Classification ... wastes Surgical wastes 1.2.1. Hazardous chemical wastes Expired medicine, low quality medicine Harmful chemical factor in healthcare Wastes harm cell Wastes contain heavy metal ... medical wastes in Vietnam Public economics had manual incinerator. In other hospitals, the manual incinerator is burned and leaves an uncomfortable smell According to the “Regulation of medical waste
Ngày tải lên: 23/09/2012, 15:38
Testing a model of customer-based brand equity in the Vietnamese banking servic
... perceived quality, 4) brand associations (which are driven by brand Trang 19identity: the brand as a product, the brand as an organization, the brand as a person and the band as a symbol) The ... quality and can be expressed by an equation of performance and expectations, service quality = [performance – expectations] (Cronin and Taylor, 1992; Parasuraman et al, 1988) Rational associations ... details Trang 33Figure 2.4 Research Model of Customer-Based Brand Equity Rational associations Brand Evaluations Customer-Brand Relationship Rational Evaluation Emotional Evaluation
Ngày tải lên: 06/11/2012, 15:52
Would a Roshanda by Any Other name smell as sweet
... Popular Girls’ Names of 2015? Annika Ansley Ava Avery Aviva Clementine Eleanora... Ella Emma Fiona Flannery Grace Isabel Kate Lara Linden Maeve Marie-Claire Maya Philippa Phoebe Quinn Sophie Waverly ... 174 4 Lauren 5 Ashley 6 Amanda A Roshanda by Any Other Name 7 Megan 8 Samantha 9 Hannah 10 Rachel 11 Nicole 12 Taylor 13 Elizabeth 14 Katherine 15 Madison 16 Jennifer 17 Alexandra 18 ... names and hippie names, nostalgic names and place names Increasingly, there are brand names (Lexus, Armani, Bacardi, Timberland) and what might... cases the standard spellings of the names— Tabitha,
Ngày tải lên: 17/10/2013, 18:20
Tài liệu Figure Drawing Without A Model - Character and Expression doc
... w7 ha" alt=""
Ngày tải lên: 21/01/2014, 08:20
Bạn có muốn tìm thêm với từ khóa: