fetching a page reference by a url

... the pants" based on the squeeze pages we've tested HAVING that stupid sentence on your squeeze page DECREASES overall response ANYWAY So there is no SANE reason to have it on their at all What ... optin page Fact - it will ALWAYS decrease your response if you capture their name So what you instead? Just collect email That's it Nothing else Yep, you can't that stupid "name personalization" ... your autoresponder sequence but who falls for that crap anyway? And you really want to "trick" your prospects into buying form you? I don't So there is no reason to collect a name on an option page...

Ngày tải lên: 27/06/2014, 23:20

... particularly well suited SQL is a database language for relational databases that uses the relational data model What exactly is a relational database? How is data stored in a relational database? ... offered Allbase, a database that supported both its HPSQL dialect and a nonrelational interface Data General's DG/SQL database replaced its older nonrelational databases as DG's strategic data management ... nonrelational databases early in its evolution and more recently has continued as a key advantage over pure object-based databases Programmatic Database Access SQL is also a database language used by...

Ngày tải lên: 03/07/2014, 04:21

... Paragraph Start 159 When does a paragraph start 159 What happens when a paragraph starts 160 Assorted remarks 160 Starting a paragraph with a box 160 Starting a paragraph with a group 160 Examples ... Paragraph filling: \parfillskip 166 Assorted remarks 166 Ending a paragraph and a group at the same time 166 Ending a paragraph with \hfill\break 167 Ending a paragraph with a rule 167 No page ... that the text has been approved by an organization as the authoritative definition of a standard You may add a passage of up to five words as a Front-Cover Text, and a passage of up to 25 words as...

Ngày tải lên: 15/03/2014, 10:20

... conducted into alternative, affordable methods of vegetation management This applies to natural as well as artificial regeneration, especially on large regeneration cuts with no remaining shelter ... philosopher Francis Bacon’s ancient adage (1620) “nature to be commanded must be obeyed” [5] Though Bacon’s Novum Organum addressed human nature rather than plants, his maxim is generally applicable; ... This applies particularly when regeneration takes place over a large area, for example, after clearcuts Irrgang’s studies [14] of vegetation clearcuts in eastern Germany indicate that during the...

Ngày tải lên: 08/08/2014, 01:22

... Association, Canadian Cardiovascular Society: ACC/AHA guidelines for the management of patients with ST-elevation myocardial infarction; a report of the American College of Cardiology/American ... the patient did not have a clear culprit coronary artery, significant coronary artery disease was not present and cardiac biomarkers were negative A patient’s arrival period was categorized as ... single page activation of the cardiac catheterization laboratory by emergency physician for patients with suspected ST-segment elevation myocardial infarction CCL: cardiac catheterization laboratory,...

Ngày tải lên: 13/08/2014, 23:20

Ngày tải lên: 08/08/2012, 17:20

... premises Medical wastes include injurious medical wastes and common wastes  Injurious medical wastes are medical wastes which contain factors that can harm man’s health and environment Those factors ... dumping waste bags to roadsides In particular, Hanoi has thousands of medical stations, making up about 2% of total wastes Only 60 hospitals and medical centers have signed up for waste treatment ... houses are non-standard, unsanitary and highly infectious In some areas, medical wastes are urgent matters because there have been no places for wastes to be gathered even in provincial hospital...

Ngày tải lên: 23/09/2012, 15:38

... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... Science Data Service approved the collection and recording of the study data Statistics Data were recorded into a database designed with File Maker (FileMaker Inc., Santa Clara, CA, USA) We used Table ... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland...

Ngày tải lên: 25/10/2012, 09:56

... remaining colon wall was normal, but the bowel preparation was poor The invagination of diverticulum has an advantage over diverticulectomy in that it minimizes bowel leakage [15] Moreover, invagination ... which makes its wall weak, as compared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers The vasa recta, which supply the mucosa and submucosa of ... Lawson HH Haemoperitoneum associated with a solitary diverticulum of the sigmoid colon S Afr Med J 1961;35:715-6 Matsagas MI, Fatouros M, Koulouras B, Giannoukas AD Incidence, complications, and...

Ngày tải lên: 25/10/2012, 10:51

... coloured and maintained for h at room temperature Then the organic phase was washed with water, followed by 1N HCl and again water The organic layer was dried over Na2SO4 and evaporated The resulting ... chloroform and ml TEA at 0-5 °C After h at room temperature, the solution was washed with water, N HCl and again with water The organic layer was dried over Na2SO4 and evaporated The residue was purified ... 215 Sakamoto S, Kyprianou N Targeting anoikis resistance in prostate cancer metastasis Mol Aspects Med 2010 Apr;31(2):205-14 Zanardi LA, Battistini L, Burreddu P, et al Targeting alpha(v)beta(3)...

Ngày tải lên: 25/10/2012, 11:40

... demonstrated that CKBM is able to inhibit cell proliferation in human gastric cancer cell line, AGS The data from a subcutaneous implantation model of gastric cancer tissue was also agreeable to ... Introduction Pharmaceutical research of traditional Chinese medicines on cancer prevention and treatment has attracted much attention There are a number of herbs that have shown to have the abilities ... 10 PI-Area (15%) 10 PI-Area (15%) PI-Area (15%) Pre-phase 19.5 G1 50.2 S 14.3 G2 35.4 PI-Area (10%) 10 10 PI-Area (15%) PI-Area (15%) Pre-phase 37.4 G1 48.5 S0 G2 51.5 PI-Area (10%) PI-Area (10%)...

Ngày tải lên: 02/11/2012, 11:12

... transmission of payment transaction data, and associated remittance advice data, from a payee to their bank, for onforwarding (via banks and/or value-added network operators) to the payee's bank ... for creating and managing Web sites and pages Because it incorporates all of Dreamweaver's page design and site management tools, UltraDev makes it easy to create, manage, and edit cross-platform, ... can spare or days, you are advised to visit Vientiane, Laos capital with legendary pagodas such as Srisakhet Hortakeo, Thatluang From Hanoi, many interesting tours are available because they are...

Ngày tải lên: 07/04/2013, 23:51

... Business Accounting Department Administrative Department Sales Department Factory Viet A plastic and composite company with abbreviated transaction nameVAPLASCOM, is a subsidiary of Viet A group ... field are known as quality management Quality management includes both quality control and quality assurance, as well as the additional concepts of quality policy, quality planning, and quality ... A plastic and composite company in terms of management responsibility and human resource management Viet A plastic and composite company, a company of designing, manufacturing and trading plastic...

Ngày tải lên: 18/04/2013, 17:09

... to thank Mr Hirofumi NAGATA for his great cooperation and the TAKAHASHI Foundation for providing financial support in this study REFERENCES Goto, M., Nada, T., Kawajiri, S., Kodama, A. , and Hirose, ... biodegradable method by thermophilic bacteria (Hasegawa et al.,1997; Imaoka et al.,1998; Li and Noike, 1992; Liu and Mori, 1993) and physical treatment (Nawa, 1995) are in development This paper ... municipal sludge by supercritical water oxidation J Chem Eng Japan, Vol.30, No.5, 813-818 Hasegawa, S., Miura, M., Katsura, K (1997) Solubilization of organic sewage by thermophilic bacteria Journal...

Ngày tải lên: 05/09/2013, 08:40

... COMPRESSED AIR INFLUENT AIR SLUDGE WASTE Fig Schematic Diagram of the Coupling of Activated Sludge Process and Membrane Separation MATERIALS AND METHODS Wastewater preparation The wastewater was obtained ... microorganism ratio (F/M ratio), sludge wastage rate, and sludge settling characteristic in sedimentation tank An increase in biomass concentration will increase degradation rate and reduce the area ... from chemical treatment is classified as a hazardous waste, so it should be treated in a proper way This means that the sludge disposal causes a substantial increase in wastewater treatment cost...

Ngày tải lên: 05/09/2013, 09:08

... Verification at point A every 10 with rainfall SCENARIO ANALYSIS FOR NITROGEN LOAD REDUCED BY ARTIFICIAL WETLANDS Scenario analysis The TN concentration at point A is calculated for artificial wetlands ... use and drainage data were added to each cell and were determined by means of a field investigation by using a land-use map and a 1:5,000 map (Fig 3) The Geographical Survey Institute in Japan ... concentrations (measurement instruments: YANACO TN-301P; DIONEX DX-100) The water was analyzed by our laboratory staff at Ibaraki University At point A, a weir was built in the drainage and the...

Ngày tải lên: 05/09/2013, 09:08

... phosphatase (alkaline, acid and phosphohydrolase), cellulase (α-glucosidase, β-galactosidase, α-mannosidase), esterase (C4 and lipase C8) and protease (leucine aminopeptidase) The enzymatic activities ... α-fructosidase α-mannosidase glucosaminidase β-glucosidase α-glucosidase β-galactosidase β-glucurosidase α-galactosidase Phosphohydrolase Acid phosphatase Chemotrypsine Trypsine Cystine aminopeptidase ... of A niger, and special thanks to Dr Pierre Wattiau for suggestions and Hélène-Christine Massart for analytical support REFERENCES Boczar B A. , Begley W M and Larson R J (1992) Characterisation...

Ngày tải lên: 05/09/2013, 09:08

... of metabolically active bacteria in activated sludge, Microbial Environ., 19, 61- 70 [15] American Public Health Association, American Water Works Association and Water Environmental Federation, ... (2005) Standard method for examination of water and wastewater, 21st ed [16] Japanese Standards Association (1998) Japanese Industrial Standards, JIS K0102 [17] Tarre, S., Beliavski, M., Denekamp, ... with a mesh- filtration unit instead of a membrane) was able to maintain biomass at a very high concentration In this process, stable filtration performance was obtained by intermittent filtration...

Ngày tải lên: 05/09/2013, 09:38

... et al., 200 7a) , water was taken from a municipal water filtering plant (Miyoshi, Hiroshima, Japan) prior to being treated for use as tap water The coliform bacteria and total bacterial counts in ... total bacterial count using the standard plate counting method One ml of appropriate dilutions of samples was inoculated in standard plate count agar (Nihon Pharmaceutical Co., Ltd., Tokyo, Japan) ... β-glucuronidase and α-glucosidase, were completely inactivated by the SC-CO2 treatment, whereas phosphatase (alkaline and acid) or naphthol-AS-BI-phosphohydrolase was slightly or a little inactivated...

Ngày tải lên: 05/09/2013, 09:38

... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... Table - Primers and TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa ... Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake Environ...

Ngày tải lên: 05/09/2013, 10:15