exploring the parts of a program

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper primer Fig Partial alignment of alkaline phosphatases at ... higher than the native cold adapted enzyme (Table 1) The mutant G26 1A/ Y26 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation of mutant and wild-type...

Ngày tải lên: 22/02/2014, 04:20

6 493 0
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần2 docx

Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần2 docx

... "Thanh Hoa" hay "Nguyen Thanh Hoa" Điều cấm kị nên bạn thật lưu tâm THE SUPERSCRIPTION (PHẦN Đ A CHỈ TRÊN B A THƯ) Các bạn lưu ý gửi thư cho người phụ nữ phải viết phần tên hiệu phần đ a b a thư ... Bởi chữ ký phần quan trọng mang tính biểu trưng thay cho bạn nên cần phải thống thư từ hay văn giấy tờ Ví dụ, tên Nguyen Thanh Hoa bạn không nên gửi thư cho người ký tên "Hoa" sau thư gửi đến người ... thư thân mật không trang trọng thường dùng: Yours sincerely, Yours very sincerely, Yours cordially, Yours faithfully, Yours gratefully, Yours affectionately, Very affectionately yours, Yours lovingly,...

Ngày tải lên: 12/07/2014, 01:20

13 598 2
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...

Ngày tải lên: 25/10/2012, 11:00

6 693 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories The multiracial population of Malaysia ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges...

Ngày tải lên: 06/03/2014, 15:21

88 583 0
The Art of R Programming: A Tour of Statistical Software Design ppt

The Art of R Programming: A Tour of Statistical Software Design ppt

... instance, in the discussion of data frames, I not only state that a data frame is an R list but also point out the programming implications of that fact Comparisons of R to other languages are also ... Data Frames A typical data set contains data of different modes In an employee data set, for example, we might have character string data, such as employee names, and numeric data, such as salaries ... (scalars) not have separate data types but instead are special cases of vectors On the other hand, as in C family languages, matrices are special cases of vectors We’ll spend a considerable amount...

Ngày tải lên: 23/03/2014, 05:24

404 2K 1
Báo cáo khoa học: A family of killer toxins Exploring the mechanism of ADP-ribosylating toxins pptx

Báo cáo khoa học: A family of killer toxins Exploring the mechanism of ADP-ribosylating toxins pptx

... This aspartate interacts with the 2-OH of ADP ribose in a manner similar to that of the catalytic glutamate of the ADPRT and this could be essential to the mechanism and form part of the mechanism ... endosomes, the low pH activates the translocation function of the B domain heptamers and they translocate the catalytic A domains across the endosomal membrane into the cytoplasm where they can act ... nearly all of the C3-like and Iota-like ADPRTs These are: (a) a tyrosine residue that interacts with the ‘S’ of the STS motif and the catalytic glutamate through hydrogen bonds, (b) an asparagine...

Ngày tải lên: 30/03/2014, 10:20

15 334 0
Báo cáo hóa học: " Exploring the bases for a mixed reality stroke rehabilitation system, Part II: Design of Interactive Feedback for upper limb rehabilitation" doc

Báo cáo hóa học: " Exploring the bases for a mixed reality stroke rehabilitation system, Part II: Design of Interactive Feedback for upper limb rehabilitation" doc

... kinematic data is used for computational assessment and generates the interactive feedback Based on observation and the computational assessment, the clinician may adapt the system extension of the ... consistency measure The average variation of the maximum speed (within a reach) over a set of ten reaches Reaching time consistency The average variation of the maximum reaching time (within a reach) ... during a reach and the reference curve derived from non-impaired reaching data that is scaled to the start and end reference angle of each participant Consistency of the angular profile The average...

Ngày tải lên: 19/06/2014, 08:20

21 441 0
báo cáo hóa học: " The effects of a graduated aerobic exercise programme on cardiovascular disease risk factors in the NHS workplace: a randomised controlled trial" pdf

báo cáo hóa học: " The effects of a graduated aerobic exercise programme on cardiovascular disease risk factors in the NHS workplace: a randomised controlled trial" pdf

... TA, Mensah GA, Alexander RW, Anderson JL, Cannon RO, Criqui M: Markers of inflammation and cardiovascular disease: application to clinical and public health practice: A statement for healthcare ... factors and disease, than actual physical activity level [25,26] As a consequence it has been shown that it is only those individuals who increase their VO2 max, rather than their actual physical activity ... design, carried out the testing, performed statistical testing and drafted the manuscript MM carried out the immunoassays GPW participated in the coordination of the study and drafting of the manuscript...

Ngày tải lên: 20/06/2014, 00:20

10 663 0
báo cáo khoa học: " Individual and setting level predictors of the implementation of a skin cancer prevention program: a multilevel analysis" docx

báo cáo khoa học: " Individual and setting level predictors of the implementation of a skin cancer prevention program: a multilevel analysis" docx

... with the management of data, participated in the analysis and interpretation of data, and provided revisions on the content of the manuscript TE coordinated the original data collection and was ... interests Authors' contributions BAR carried out data management, analysis of the data including multilevel modeling, interpretation of data, and created the first draft of the manuscript EN was involved ... using parallel statistical methods, and the two years' data were treated as replicate studies Multilevel analysis was chosen to account for the hierarchical nature of the data (lifeguards nested...

Ngày tải lên: 10/08/2014, 10:22

13 276 0
báo cáo khoa học: " The implementation of a translational study involving a primary care based behavioral program to improve blood pressure control: The HTN-IMPROVE study protocol " pot

báo cáo khoa học: " The implementation of a translational study involving a primary care based behavioral program to improve blood pressure control: The HTN-IMPROVE study protocol " pot

... relationships among constructs match the conceptual model Quantitative analysis Consistent with the organization-level focus of the conceptual model, we aggregate and analyze quantitative data at ... intervention This implementation study capitalizes on the national healthcare system of the VA to systematically examine the local adoption of an effective program aimed to manage veterans' hypertension ... et al.: The Nonspread of Innovations: The Mediating Role of Professionals Academy of Management Journal 2005, 48(1):117-34 27 Miles MB, Huberman AM: Qualitative Data Analysis: An Expanded Sourcebook...

Ngày tải lên: 10/08/2014, 10:23

13 261 0
báo cáo khoa học: " A pragmatic study exploring the prevention of delirium among hospitalized older hip fracture patients: Applying evidence to routine clinical practice using clinical decision support" potx

báo cáo khoa học: " A pragmatic study exploring the prevention of delirium among hospitalized older hip fracture patients: Applying evidence to routine clinical practice using clinical decision support" potx

... tools Acknowledgements The authors thank Barbara Bobranska-Artiuch (University of Calgary), Fatima Chatur (University of Calgary), and Pierre Duez (University of Toronto) for their support in data ... Medical Center, 1403-29th Street NW, Calgary, University of Calgary, Calgary, Alberta, Canada 2University of Toronto, Toronto, Ontario, Canada Authors’ contributions All authors made substantial ... conception and design and to interpretation of data; FK analyzed the data; JH-L contributed to the acquisition of data and drafted the manuscript; All authors were involved in revising the manuscript...

Ngày tải lên: 10/08/2014, 10:23

6 227 0
Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx

Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx

... offered a personal day structure program made by the nursing staff in collaboration with the recreational therapist Exercise and music therapy can be part of this day program Psycho-education is also ... supervising the nursing staff and recreational therapist more intensively in their execution of the day structure program and behavioral management strategy This support takes place in a regular staff ... after the diagnosis, the day structure program and behavioral management strategy should be incorporated in regular care The psychologist supervises the recreational therapist and nursing staff...

Ngày tải lên: 11/08/2014, 15:22

7 485 0
Báo cáo y học: " Study protocol: The development of a pilot study employing a randomised controlled design to investigate the feasibility and effects of a peer support program following discharge from a specialist first-episode " pdf

Báo cáo y học: " Study protocol: The development of a pilot study employing a randomised controlled design to investigate the feasibility and effects of a peer support program following discharge from a specialist first-episode " pdf

... PSW and the participant will take place on-site with the case manager and the peer support coordinator present The nature of the intervention will be explained again and both the participant and ... in a treatment questionnaire (see below) and via a telephone call made by the RA to the new treating clinician asking about attendance at appointments and medication adherence These treatment adherence ... motivation Similarly, the control group is asked how much more motivated they expect they would have been, had they had a PSW The questionnaires each contain qualitative and quantitative items; the...

Ngày tải lên: 11/08/2014, 16:22

7 444 0
w