explain microkernel operating system structure with an aid of a diagram

Tài liệu Báo cáo khoa học: Crystal structure of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase complexed with an analogue of 1,3-bisphospho-D-glyceric acid Selective inhibition by structure-based design docx

Tài liệu Báo cáo khoa học: Crystal structure of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase complexed with an analogue of 1,3-bisphospho-D-glyceric acid Selective inhibition by structure-based design docx

... oligonucleotides: a sense primer 5¢-CAACAAATTTGCATATGACTATT AAAG-3¢ containing an NdeI site (underlined) next to the start codon of the T brucei gGAPDH gene; an antisense primer 5¢-CAGCCAAGCGCCTAGGGAGCGAGA AC-3¢, ... Scientific, San Carlos, CA Ramachandran, G.N., Ramakrishnan, C & Sasisekharan, V (1963) Stereochemistry of polypeptide chain configurations J Mol Biol 7, 95–99 Jakeman, D.L., Ivory, A. J., Williamson, ... Pi mutant (Thr225Ala: 0.4% activity remaining) than the Ps mutant (Thr196Ala: 9% activity remaining) For the trypanosome enzyme, Km for 1,3-BPGA and GAP increased significantly in the Pi mutant;...

Ngày tải lên: 20/02/2014, 02:21

13 594 0
Thermal comfort and indoor air quality evaluation of a ceiling mounted personalized ventilation system integrated with an ambient mixing ventilation system

Thermal comfort and indoor air quality evaluation of a ceiling mounted personalized ventilation system integrated with an ambient mixing ventilation system

... Zukowska Daria, Schiavon Stefano, Haneda Masaoki and Simonsen Peter Slotved The financial supports from National University of Singapore, ASHRAE graduate Grant-in -aid (2007) and Chinese Government Award ... which shares 40% land surface of the earth The characteristics of tropical climate are abundant rainfall and high humidity associated with a low diurnal temperature range and relatively high air ... such as computers Thus, air temperature and contaminant concentrations develop vertically, with cool and less contaminated air at low level and warm and more contaminated air at a higher level of...

Ngày tải lên: 14/09/2015, 08:37

300 254 0
 Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... the data, performed the statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved the final manuscript ... Foundation for Acute Medicine and a research fellowship from the Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak,...

Ngày tải lên: 25/10/2012, 09:56

6 618 0
Báo cáo khoa học: "SEMANTIC STRUCTURE WITH ANALYSIS ADNOMINAL OF JAPANESE PARTICLES NOUN PHRASES" pot

Báo cáo khoa học: "SEMANTIC STRUCTURE WITH ANALYSIS ADNOMINAL OF JAPANESE PARTICLES NOUN PHRASES" pot

... scientific and newspaper articles, and the appropriateness of the classification of A no B investigated In addition, as a preliminary experiment, a semantic relation analysis was tried with about a thousand ... S., A Shimazu, and H Nomura, "Classification of Modality Function and its AppLication to Japanese Language Analysis," in Proceedings of the 23rd Annual Meeting of the ACL, 1985 [7] Nomura, w., ... Unification Based Approaches to Grammar, CSLI Lecture Notes Series, No 4, 1986 [10] Shimazu, A. , S Naito, and H Nomura, "Japanese Language Semantic Analyzer based on an Extended Case Frame Model,"...

Ngày tải lên: 17/03/2014, 20:20

8 347 0
Báo cáo khoa học: Modelling and simulating interleukin-10 production and regulation by macrophages after stimulation with an immunomodulator of parasitic nematodes potx

Báo cáo khoa học: Modelling and simulating interleukin-10 production and regulation by macrophages after stimulation with an immunomodulator of parasitic nematodes potx

... dynamics of Av17 and macrophages and allow refining of the mathematical model that we currently have A mathematical model goes hand in hand with experimental models It is a caricature of reality, and ... topologies of the receptor-stimulated kinase ⁄ phosphatase signalling cascades and analysed key parameters that characterize the signalling pathways (signal amplitude, signalling time, and signal duration) ... than 10 years A parasitic nematode of rodents, Acanthocheilonema viteae, is used as an animal model to study basic questions of host–parasite interaction, e.g host immune responses and parasite...

Ngày tải lên: 29/03/2014, 23:20

16 258 0
báo cáo khoa học: "Changes in physiological tremor associated with an epileptic seizure: a case report" doc

báo cáo khoa học: "Changes in physiological tremor associated with an epileptic seizure: a case report" doc

... research was funded by a Natural Science and Engineering Research Council of Canada through a Master’s scholarship (BC), Undergraduate Student Research Award (MR) and operating grant (CD) as well ... considered as another possible pre-ictal or ictal manifestation Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying Page of images A ... Montréal, Montréal, Québec, Canada Authors’ contributions J-FD created the protocol, analyzed and interpreted the data from our patient regarding tremor and electromyography, and was a major contributor...

Ngày tải lên: 10/08/2014, 23:20

6 334 0
Báo cáo y học: "Central retinal artery occlusion and non-arteritic anterior ischemic optic neuropathy associated with an overlap syndrome: a case report" pptx

Báo cáo y học: "Central retinal artery occlusion and non-arteritic anterior ischemic optic neuropathy associated with an overlap syndrome: a case report" pptx

... literature We describe such a patient who developed rapid progression of glaucomatous damage and severe ocular ischemic events Case presentation An 87-year-old woman with type-2 diabetes and systemic ... Fundoscopy showed a cup-to-disc ratio of 0.5 and 0.7, respectively This asymmetry of structural damage was attributed to the XFS onset and additional antiglaucoma topical treatment was initiated OS Six ... Six months later, the patient complained of a marked decrease of vision OS, and a central retinal artery occlusion (CRAO) was confirmed by clinical and fluorescein angiographic examinations Over...

Ngày tải lên: 11/08/2014, 19:21

4 225 0
activate cognition activity of student in physics teaching via using experiment with the aid of computer (demonstrated via chaptercurrent in different environment 11th grade advanced pro

activate cognition activity of student in physics teaching via using experiment with the aid of computer (demonstrated via chaptercurrent in different environment 11th grade advanced pro

... Mountainous, lowland, urban - Activation must be made for each separate stages, factors of teaching process like contents, methods, means, mode of organization All those issues can be regarded ... allow storage, display, establish table and check mathematically of real line The software can be provided with sensor and “Compatible coupling devices” (available software) or must be established ... Experimenting with the aid of Com with a view to activating CA of students The use of Com in particular and IT in general in teaching has become a special characteristics of modern schools In Vietnam,...

Ngày tải lên: 24/08/2014, 14:01

27 299 0
lecture operating system chapter 07 - Multimedia University of technology

lecture operating system chapter 07 - Multimedia University of technology

... Compression The JPEG Standard (1) RGB input data and block preparation The JPEG Standard (2) One block of the Y matrix and the DCT coefficients The JPEG Standard (3) Computation of the quantized DCT coefficients ... Standard (1) Order of quantized values when transmitted The MPEG Standard (2) MPEG-2 has three kinds of frame: I, P, B Intracoded frames - Self-contained JPEG-encoded pictures Predictive frames ... frame to zero • Fast forward/backward are trickier – compression makes rapid motion complicated – special file containg e.g every 10th frame Near Video on Demand New stream starting at regular...

Ngày tải lên: 18/10/2014, 15:30

32 370 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx

Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx

... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work...

Ngày tải lên: 16/01/2014, 21:20

8 493 0
Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf

Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf

... with PYMOL [47] able sequences, some bacterial family 19 chitinases have catalytic domains that are at least as large as those of the plant enzymes and that may contain at least six subsites ... Haemophilus influenzae, and Pseudomonas aeruginosa Although many plant family 19 chitinases are known, crystal structures are available for only two of these [9,15–17] The first structure of a ... substrate-binding affinity and cis-dominant increase of antifungal function Biosci Biotech Biochem 66, 1084–1092 35 Kawase T, Yokokawa S, Saito A, Fujii T, Nikaidou N, Miyashita K & Watanabe T...

Ngày tải lên: 07/03/2014, 11:20

12 401 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo khoa học: Genomic structure, expression and characterization of a STAT5 homologue from pufferfish (Tetraodon fluviatilis) ppt

Báo cáo khoa học: Genomic structure, expression and characterization of a STAT5 homologue from pufferfish (Tetraodon fluviatilis) ppt

... AAG GAG GCC ACC AAT CGT ATC CAG G AAA TAC CGA CTG CTG CAG TCA TG CTG GTT ACC AG AAC ACA AGG AA TTC AGG AAC ATG TTT CAA GTG AAG TTT GCA GAG CCG CAG TTT AAC AGG TGG AAC GAC GG AAC AAA GCA G CCG CCC ... mut STAT5 AGATTTCTAGGAATTCAATCC AGATTTAGTTTAATTCAATCC STAT6 CCGCTGTTGCTCAATCGACTTCCCAA GAACA CCGCTGTTGCTCAATCGACTAGCCAA GAACA GCCGTGTAGTTTCTTGGAAATTTCTGG GCCGTGTAGTTTAGATTAAATTTCTGG mut STAT6 Int16 ... CATGTTATGCATATTCCTGTAAGTG CATGTTATGCATATTGGAGTAAGTG STAT3 mut STAT3 GATCCTTCTGGGAATTCCTAGATC GATCCTTCTGGGCCGTCCTAGATC STAT4 mut STAT4 GAGCCTGATTTCCCCGAAATGATGAGC GAGCCTGATTTCTTTGAAATGATGAGC STAT5 mut...

Ngày tải lên: 31/03/2014, 07:20

14 463 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

... Dutta P, Bhattacharya SK, Krishnan T, Kobayashi N, Naik TN: Genetic variability of human rotavirus strains isolated from Eastern and Northern India J Med Virol 2004, 72:156-161 Rahman M, Sultana ... Podder G, Faruque AS, Matthijnssens J, Zaman K, Breiman RF, Sack DA, Van Ranst M, Azim T: Typing of human rotaviruses: nucleotide mismatches between the VP7 gene and primer are associated with genotyping ... Rotavirus epidemiology and surveillance Novartis Found Symp 2001, 238:125-147 Arista S, Giammanco GM, De Grazia S, Colomba C, Martella V: Genetic variability among serotype G4 Italian human rotaviruses...

Ngày tải lên: 20/06/2014, 01:20

4 330 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_1 docx

Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_1 docx

... king A well-designed suit can make a man look successful, sophisticated, and chic A pinstripe, a favorite of lawyers and investment bankers, can make a small man look tall or a chunky man look ... taste and balance If you work for a conservative company, the classic pearl necklace is a safe choice, or you can wear a larger pearl bead if you want to look more contemporary Also beware of ... for a change The best fragrances are light, and outdoorsy scents are among my favorites If you don’t like or are allergic to fragrances, choose a bath or shower soap with a pleasant aroma I like...

Ngày tải lên: 21/06/2014, 03:20

23 437 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_2 pptx

Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_2 pptx

... men and women who are apples should avoid tight-fitting jeans and pleated pants YY Rectangle If you are a rectangle, you don’t have many curves, and your body shape is more like a straight-up-and-down ... that doesn’t suit your pate, then hair transplants where you can’t see the plugs are another option William Shatner (“Star Trek,” “Boston Legal”) has a good transplant 4 What Kind of Colleague ... before making a move and not work well with Relaters or Socializers To work well with a Thinker, you must be systematic, organized, and well prepared List both the pros and cons of any plan, and...

Ngày tải lên: 21/06/2014, 03:20

23 423 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_4 doc

Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_4 doc

... workshops, asking them to identify the most important factor in arriving at first impressions The participants included Caucasians, A ­ frican-Americans, Latinos, and Asians between the ages of 20 and ... it Europeans also eat salads and cheese after their entrée European portions tend to be smaller than Americans are used to, so don’t complain to the waiter at a French restaurant that you were ... hungrily awaiting your arrival 15. True.  Always send a thank-you note after being taken out to a restaurant, whether it is handwritten or an e-mail 16. False.  It is rude to text or speak on a cell...

Ngày tải lên: 21/06/2014, 03:20

23 416 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_5 doc

Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_5 doc

... together increase The following words and phrases are not a part of my regular business vocabulary: afraid can’t bad luck cheated blame crisis C an You He ar Me Now?     135 delay insist demand loss ... professional image and get your point across quickly and efficiently Remember, e-mails leave a paperless trail and can easily go viral with one quick C an You He ar Me Now?     129 click of ... message was received YY Do not attach unnecessary files Sending large attachments is annoying and can clog up an e-mail system Wherever possible, try to compress attachments and send attachments...

Ngày tải lên: 21/06/2014, 03:20

23 416 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_6 doc

Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_6 doc

... YY I can lose weight YY I can stop smoking YY I can heal YY I can let go of guilt YY I can gain self-confidence YY I can let go of fear YY I can take risks YY I can change YY I can be a winner ... displaying your fears of abandonment Shake a few times, and then break YY Too many rings Be careful not to wear too many large rings when you are shaking hands (not good business attire anyway), ... informal conversations can lead to an actual job down the road or to a reference for an opening elsewhere They are typically shorter than job interviews, which can last anywhere between an hour and...

Ngày tải lên: 21/06/2014, 03:20

23 392 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_7 pptx

Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_7 pptx

... buzzwords are job titles (sales manager, project manager, network administrator), specific skills (HTML, project management, financial analysis), and education (M.B .A. , B .A. , B.S.) Examples of business ... California more laid-back) and the variety of corporate cultures based on industries (financial and legal are more conservative, while advertising, technology, and publishing are more informal), ... fee That said, it is also important to recruiters not to offer a candidate who will then turn around and refuse the job because of a salary dispute You must be honest with a headhunter about...

Ngày tải lên: 21/06/2014, 03:20

23 287 0
w