experimental investigation of transient cutting force in evc

... discretization of the continuous rib The present investigation was therefore, taken up to determine the optimum width of a gap in the inclined rib to form discrete rib This study will help in determining ... An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs K R Aharwal 1, B K Gandhi 2, J S Saini 2 1 Department of Mechanical Engineering ... for enhancement of heat transfer heated surface to the working fluid In the present work experimental investigations has been carried out to study the effect of a gap in the inclined rib on the...

Ngày tải lên: 05/09/2013, 16:10

... the optimal cutting parameters and cooling conditions for minimizing cutting force include the use of Nanofluid-based MQL for cooling, a cutting velocity of 80 m/min, a depth of cut of 0.2 mm, ... on the machining input parameters that significantly influence machining performance, specifically examining the effects of cutting fluids, workpieces, machining conditions, and cutting tools, ... achieving optimal surface roughness (Ra) and cutting force (Ft) were determined to be a cutting speed of 100 m/min, a feed rate of 0.0150 mm/tooth, and a depth of cut of 0.44 mm, resulting in Ra...

Ngày tải lên: 24/10/2021, 23:19

... sets of rupture disks, working in parallel, for full re-dundancy are located (to guarantee that, in case of partial opening of one of the two sets of rupture disks, the opening pressure of the ... pressure of the water at the prevailing temperature to avoid boiling at water head interface, in inert atmosphere by using the evacuation system of the Safety Drain Tanks The design of the SLT ... tanks in the DTR; b) location of the VVPSS in the Drain Tank Room tanks with indication of tanks are then functionally divided into the two categories of LLTs and SLT, and c) overview of STs and of...

Ngày tải lên: 24/12/2022, 01:02

... machinability of difficult-to-cut materials by examining their machining under various cutting conditions, including dry, Minimum Quantity Lubrication (MQL), and nanofluids, while varying cutting ... research investigated the machining of challenging-to-cut materials under three cutting conditions: dry, Minimum Quantity Lubrication (MQL), and nanofluids Flood cutting (wet cutting) was intentionally ... machining processes.Figure 2 15 Sustainability assessment in metal cutting [77] Increasing energy efficiency in machining is essential for reducing overall energy consumption and minimizing environmental...

Ngày tải lên: 22/08/2023, 00:59

... reduction in air fuel ratio due to increase of BSFC, Trang 8leading to increase in temperature of combustion chamber The presence of oxygen molecules in the JOME can also play a valuable roll mainly in ... fuel consumption requires the increase of volume and duration of fuel injection Since the fuel was injected at fixed injection timing more fuel was injected during the expansion stroke and leads ... leakage in the pump due to its higher viscosity leading to an increase in the injection line pressure Thus needle opens at an earlier point than the diesel fuel The advance start of injection...

Ngày tải lên: 05/09/2013, 16:11

... so financial institutions and investors are also less interested in these types of firms and they are less interested in the analysis of stocks of these small firms This could cause stocks of ... DISCUSSION OF RESULTS In this section, we present the empirical findings and an in-depth analysis of the results This section begins with necessary steps for testing multi-collinearity including correlation ... advising from the very first to the final steps of mine in conducting the work leading to this thesis I would like to express my sincere gratitude to all of my lecturers for their teaching and...

Ngày tải lên: 27/09/2013, 21:53

... Organization of the Remaining Chapters i REVIEW OF LITERATURE Contingency Theory Transfer Pricing in General Prior Empirical Research IV ANALYSIS AND PRESENTATION OF FINDINGS Characteristics of Responding ... differing motivational criteria of companies in choosing a transfer pricing method, including profit maximization, performance evaluation of divisions, goal congruence, and the ease of understanding ... used by multinational corporations The findings indicate that factors, both internal and external to the company, play a key role in determining a company's international transfer pricing policy...

Ngày tải lên: 18/02/2014, 11:20

... that has appeared in literature focus on implementing variations of a single protocol Herein, we are presenting an experimental investigation of several cooperation schemes, some of which are sophisticated ... receiving the training signal from the source, the relays take turns sending a training signal to the destination The destination estimates the best sampling offset for each relay from the training ... resolving the difficulties of installing multiple antennas on small communication terminals In cooperative communication, a number of relay nodes are assigned to help a source in forwarding its information...

Ngày tải lên: 21/06/2014, 20:20

... This group includes ischemic episodes of Prinzmetal’s angina due to vasospasms, of unstable angina due to thrombosis, and of microvascular angina Determining the type of ischemia (in-creased ... largest during the morning interval, and the lowest during the night interval, which is in agreement with observations in [13,14] This indicates a much greater risk of ischemia in the morning interval ... present during the night, and noise, which is not as frequent during the sleeping period as it is during the wake period The morning inter-val was defined as a 90-minute interinter-val following the...

Ngày tải lên: 22/06/2014, 20:20

... obtained using similar procedures [20] Multiplication of embryogenic lines via secondary embryogenesis was most frequently accomplished using culture media containing the cytokinin BAP, with auxin ... compara-tively less investigated although it directly contributes to the final plant yield and influences the ability of the re-sulting embryos to germinate and develop into growing plantlets Two main problems ... 1 INTRODUCTION Somatic embryogenesis involves control of 3 consec-utive steps: (i) induction of embryogenic lines from sporophytic cells; (ii) maintenance and multiplication of embryogenic lines;...

Ngày tải lên: 08/08/2014, 14:20

... analytical force model is developed for in- depth understanding of the transient cutting mechanics and for accurate prediction of the transient cutting force In this model, transient thickness of cut ... marks in turning WCC J Cutting energy consumption in CC WCVC J Cutting energy consumption in CVC WEVC J Cutting energy consumption in EVC ∆TCC o Temperature rise in CC ∆TCVC o Temperature rise in ... 32 Chapter 3: Experimental investigation of transient cutting force in EVC 34 3.1 Characteristics of the EVC process 35 3.1.1 Transient thickness of cut 35 3.1.2...

Ngày tải lên: 09/09/2015, 10:21

... The slope of the line (not shown) at both temperatures is ∼1 verifying that the measured rate is independent of the influence of transport effects Table also contains a compilation of apparent ... The minimal change in SBA-15 physical parameters after incorporation of Pt into the silica reveals that there is no significant blocking of the SBA-15 channel by Pt particles 3.2.2 Efficient Incorporation ... K) Examining the hydrogenolysis of ethane over a wide range of experimental conditions, Gudkov suggested that the ratedetermining step changes with reaction conditions At high ratios of hydrogen...

Ngày tải lên: 08/10/2015, 23:16

... value of viscosity increased with increasing concentrations of 1alkanols and decreased with increasing temperature As the number of hydrocarbon groups or the chain-length of the alcohol increased, ... that in the case of liquid systems, including electrolytic solutions, there is no serious harm in assuming cubic packing and equating b to 3.3 Gibb’s Free Energy (ΔG*) On the basis of Eyring rate ... mixtures of weakly7 or strongly interacting components.8 The study of molecular associations in organic ternary mixtures having an alcohol as one component is of particular interest since alcohols...

Ngày tải lên: 07/08/2014, 14:20

... original authors (mainly urine protein excretion, serum creatinine or creatinine clearance, or a combination of these) and subsequent relapse Adverse events sought included mortality, infection (especially ... evaluation of homogeneity tests in meta-analyses in pain using simulations of individual patient data Pain 2000, 85:415-424 33 L'Abbe KA, Detsky AS, O'Rourke K: Meta-analysis in clinical research Ann Intern ... residual bias in observational studies and lack of blinding in randomised trials The amount of information for MMF is greater than for cyclophosphamide and azathioprine in this indication, and...

Ngày tải lên: 09/08/2014, 08:23

... Determination of salt gland density in A officinalis leaves 67 Figure 3.4: Salt gland structure from A officinalis leaves 69 Figure 3.5: Estimation of ions in xylem sap of A officinalis ... Quantification of hormones in leaves of two-month-old A officinalis seedlings up on salt treatment 77 Figure 3.9: Quantification of hormones in roots of two-month-old A officinalis seedlings ... CCATTAGGTGGCCAGCTCTC 24 Annotation Cloning Cloning Cloning Cloning qRT-PCR primers qRT-PCR primers Cloning Cloning Cloning Cloning qRT-PCR primers qRT-PCR primers Cloning Cloning Cloning Cloning qRT-PCR primers...

Ngày tải lên: 09/09/2015, 08:13

... penetration in clayey soil is likely to be undrained Soil profile containing a thin layer of stiff clay or crust overlying soft clay, hereafter referred to simply as two-layer clay, is often found in ... penetration, resulting in a progressive indentation in the soft clay while the spudcan is still within the crust layer The progressive indentation in the soft clay is expected to mobilise increasing resistance ... penetration in sand overlying clay and in two-layer clay The findings obtained in the study of spudcan penetration in sand overlying clay may therefore not be applicable to the case of two-layer...

Ngày tải lên: 10/09/2015, 15:54

... simulation of a single stage pressurized adsorption cooling system in term of system behaviour and cycle performance To study experimentally the transient behaviour and performance analysis of a single ... two problems arising out of this source Firstly, a lot of care has to be exercised in handling them Particularly, during filling, they tend to get fluidized when compacting During operation, they ... required Chapter Introduction to maintain a continuous operation or flow of refrigerant since the adsorption and desorption processes are intermittent and occur over a period of time The processes...

Ngày tải lên: 11/09/2015, 10:01

... possibility of integrating MEG into the carrier generation mechanism of SiNW PV devices It aims at fabricating an array of ultra-thin SiNWs in which MEG phenomenon could be detected In Chapter ... data of SiNW surface and planar Si surface, measured using integrating sphere (b) Reflected spectral irradiance of SiNW surface comparing with that of planar Si surface; the inset shows incident ... highlighting the advantages and promising prospect of SiNWs in the design and fabrication of third generation solar cells In previous works, SiNWs were fabricated using a variety of methods, which mainly...

Ngày tải lên: 12/10/2015, 17:35

... monitoring in terms of determining the IMPDH activity in lymphocytes would be useful in the direct investigation of biologic response to MMF therapy Investigations at PD level would aid the in- depth ... target of rapamycin Mammalian target of rapamycin Molecular weight cutoff Mizoribine Nicotinamide adenine dinucleotide Other race Every morning One compartment model Phosphate Buffer Saline Pharmacodynamic ... drug regimen of a calcineurin inhibitor cyclosporine A (CsA), prednisolone and azathioprine A calcineurin inhibitor tacrolimus (TAC), a mTOR 10 (mammalian target of rapamycin) inhibitor Sirolimus...

Ngày tải lên: 28/11/2015, 13:44

... binary mixture (obtained from 154 heating T profiles of Series A) 143 150 xx List of Figures Figure 7.18 Phase diagram of CBE-CBU binary mixture (obtained from 155 heating T profiles of Series B) Figure ... operation since the late 1970s for decaffeination of coffee and tea, refining of cooking oils, recovering of flavors and pungencies from spices, hops, and other plant materials A compilation of proven ... thermo-diagrams of the CBE-CBU system: Series C 153 (heating) Figure 7.16 Phase diagram of CBE-CBU binary mixture (obtained from 154 heating T profiles of Series C) Figure 7.17 Phase diagram of CBE-CBU binary...

Ngày tải lên: 17/09/2015, 17:19