example of when you dealt with a challenging situation

... associated with the Choi-Saigo-Srivastava operator,” Journal of Mathematical Analysis and Applications, vol 320, no 2, pp 779–786, 2006 17 R W Barnard and Ch Kellogg, “Applications of convolution ... Journal of Mathematical Analysis and Applications, vol 259, no 2, pp 566–581, 2001 7 B C Carlson and D B Shaffer, “Starlike and prestarlike hypergeometric functions,” SIAM Journal on Mathematical ... functions,” Annales Universitatis Mariae Curie-Skłodowska Sectio A, vol 45, pp 89–97, 1991. 6 J.-L Liu and H M Srivastava, “A linear operator and associated families of meromorphically multivalent

Ngày tải lên: 21/06/2014, 20:20

... Y C Kim, and H M Srivastava, “The Hardy space of analytic functions associated with certain one-parameter families of integral operators,” Journal of Mathematical Analysis and Applications, vol ... functions associated with a family of multiplier transformations,” Journal of Mathematical Analysis and Applications, vol 300, no 2, pp 505–520, 2004 R M El-Ashwah and M K Aouf, “Hadamard product of ... Mathematical Analysis and Applications, vol 3, no 1, article 8, 11 pages, 2006 25 T N Shanmugam, S Sivasubramanian, B A Frasin, and S Kavitha, “On sandwich theorems for certain subclasses of analytic

Ngày tải lên: 22/06/2014, 02:20

... (5’-CCTCAAAGTTCTCAG-TAACGTCACCTCCAGCTTG-3’) and A59V-F (5’-CAA GCTGGAGGTGACGTTACTGAGAACTTTGAGG-3’); ’-GGCATCTGTAGAGTGC-GAGACATCCTCAAAGTTC-3’) and G67S-F (5’-GAA CTTTGAGGATGTCTCGCACTCTACAGATGCC-3’) After ... L51I-R (5 and L51I-F (5’-GGTGGGGAAGAAGTTATCAGGGAA-CAAGCTGG-3’); for L51T, L51T-R (5’-CCAGCTT GTTCCCTTGTAACTTCTTCCCCACC-3’) and L51T-F (5’-GGTGGGGAAGAAGTTACAAGGGAACAAGCT GG-3’); for A59V, A59V-R ... higher than the indicated values The average of the cathodic and anodic peak potentials was taken as the formal potential All potentials were measured at 25°C versus an Ag/AgCl electrode with an internal

Ngày tải lên: 10/08/2014, 05:21

... GeneSapiens database Data analysis All data analysis was done with R [25] Accuracy versus best similarity score The test samples were arranged according to the highest similarity score they had attained ... GeneSapiens database [23] This approach has the advantage of improving constantly as more data are acquired and as algorithms are optimized This also allows more flexible customization of the ... types, each class having an average of 100 samples per class, with a minimum of 6 (Additional file 2) Less than 1% of the samples were metastases; we thus refer to the reference data as primary cancer

Ngày tải lên: 11/08/2014, 12:21

... data reveal that a relatively toxic anti-inflammatory drug, such as aminopterin, can be targeted with folic acid to inflammatory macrophages and thereby relieve inflammatory symptoms with greatly ... investigated the biological activities of EC0746, a FA-AMT conjugate designed to intracellularly deliver an AMT analog specifically via the FR The anti-inflammatory activity of EC0746 was evalu-ated ... remedially affect cytokine responses associated with macrophage activation, and that the observed anti-inflammatory action of EC0746 can be independent of anti-macrophage proliferation Assessment of

Ngày tải lên: 12/08/2014, 15:22

... 3 Another example of figure placement in your body of thesis and its label 16  Trang 9LIST OF TABLES 1 Example of table placement in your body of thesis and its label 12  2 Another example ... example of table placement in your body of thesis and its label 13  3 Another example of table placement in your body of thesis and its label 14  4 Another example of table placement in your ... body of your thesis Please check that your body of thesis consistency in term of font type, font size, spacing, and margin are maintained Table 2 Another example of table placement in your body of

Ngày tải lên: 06/06/2016, 14:31

... Japan for 6 Vietnamese managers to learn about Plant Quarantine Administration (2005 and 2006) Trang 20 Commitment and performance of Vietnamese and Japanese counterparts. Japanese scientists ... disinfestation technique of fruit flies that complies with international standard to improve Vietnamese dragon fruits’ access to international market. Vietnamese staff trained to be capable of applying ... fiscal year and the time when Vietnam counterparts had to draw up final financial balance-sheets Trang 38 Timely decision-making and support from MARD, Plant Protection Department and leadership

Ngày tải lên: 27/06/2016, 20:26

... Japan) operated at an accelerating voltage of 12 kV Transmission electron microscope (TEM) images were obtained on a JEOL JEM-2010 TEM (JEOL Ltd., Tokyo, Japan) with an accelerating voltage of ... (XRD) characterization was obtained using a D/MAX Rint 2000 diffractometer model (Rigaku, Tokyo, Japan) with CuKα radiation (λ = 1.54178 Å, 40 kv, 200 mA) The Raman spectra were taken using a Jasco ... by a step process using expanded graphite (EG) as a starting material EG was subjected to solvothermal treatment, followed by microwave radiation The FLG had an average thickness in the range of

Ngày tải lên: 12/12/2017, 06:53

... courses you can expect to take as a general busi-ness major You’ll also discover ways to tailor your education to helpyou land that dream job when you graduate—or, at the very least, anentry-level ... Environmental Policy and Management,Finance, Global Analysis, Health Care Management and Policy, Insuranceand Risk Management, Legal Studies, Management, Managing ElectronicCommerce, Marketing, Marketing ... one of the following area studies programs: cred-◆ African Studies ◆ Central Eurasian Studies ◆ East Asian Studies ◆ Latin American and Caribbean Studies ◆ Near Eastern Studies ◆ Russian and East

Ngày tải lên: 23/05/2018, 13:53

... this article: Rajadurai, G., S Varanavasiyappan, N Balakrishnan, V Udayasuriyan, D Sudhakar and Natarajan, N 2018 Development of Transgenic indica Rice with a Chimeric cry2AX1 Gene against Leaffolder, ... Balakrishnan, N., Ruturajrajan, B., Naveenkumar, A., Sozhavendan, A.E., Nandeesha, P., Illakkiyapriya, A., Balasubramani, V., Kumar, K.K., Sudhakar, D and Udayasuriyan, V 2012 Genetic transformation ... S Varanavasiyappan2, N Balakrishnan2, V Udayasuriyan2, D Sudhakar2 and N Natarajan1* Department of Agricultural Entomology, 2Department of Plant Biotechnology, Agricultural college and Research

Ngày tải lên: 21/05/2020, 21:48

... color was noted for each of the individuals Traits were analyzed with one-way ANOVA, where specie was treated as a fixed factor When variances within each taxon were equal, as determined by a Levene ... hypothesized as natural hybrids, and mostly occurred along a main road in the scenic area of Xishan B officinalis individuals can be found throughout the area, and certainly more than 500 individuals can ... Measurements and data analysis of morphological traits Three leaves from ten healthy individuals for each of the three taxa were sampled from Xishan Mountain and then taken to KBG for morphological measurements

Ngày tải lên: 26/05/2020, 21:31

... with the available experimental data from X-ray diffraction analysis [31] As a whole, there is a perfect harmony between the theoretical data and the experimental structure for the ground state ... are also parallel and their planes are separated by 1.94 Å, approximately 3 times as much as that in 4 Therefore, the dihedral angle between pyrene ring and the plane of N1-O1-O1i-N1i was measured ... N1-O1-O1i-N1i was measured at 34.9o, about 2 times as much as that in 4 (15.9o) Another notable point is that the plane of seven carbon atoms of the long alkyl chains of 2 is nearly parallel to pyrene

Ngày tải lên: 09/08/2020, 17:08

... 5′-GATCCCCGCGAAGGAAGTCA AATACTTTCAAGAGAAGTATT TGACTTCCTTCGC TTTTT-3′ and 5′-AGCTAAAAAGCGAAGGAAGTCA AATA C TTCTCTTGAAAGTATTTGACTTCCTTCGC GGG-3′; Sequence B, 5′-GATCCCCC ACAAGTCCCTT TCCTGGTTTCAAGAGAACCAGGAAAGGGACTTG ... and 5′-AGCTAAAAACACAAGTCCC TTTCCTGGTTCTCTTGAAACCAGGA AAGGGAC TTGTGGGG-3′; Sequence C, 5′-GATCCCCGGAGAT CCAGTCTGTCT ACTTCAAGAGAGTAGACAGAC TGGATCTCCTTTTT-3′ and 5′-AGCTAAAAAG GA GATCC AGTCTGTCACTCTCTTGAAGTAGACAGAC ... Liaoning, China), according to the manufacturer’s instructions Pri-mer sequences were: Pygo2-for: 5′-GAAGCGAAGGAAGTCAAATAC-3′; Pygo2-rev: 5′-GCACAGGACTGCCAAGGAA-3′; β-actin –for: 5′-AGAGCTACGAGCTGCCTGAC-3′;

Ngày tải lên: 05/11/2020, 05:49

... you play with a yo-yo ? Can you do a puzzle? Can you hit the ball? Trang 4 Thursday,March 18 th 2010.UNIT4: LET S TALK LET S TALK. ’ ’ P51 +52: What s wrong? What s wrong? ’ ’ I.Vocabulary: ... wrong?’ S2: can t ’ S2: can t ’ catch the ball. S1: What s wrong?’ S1: What s wrong?’ S2: can t ’ S2: can t ’ read the book. S1: What s wrong?’ S1: What s wrong?’ S2: can t ’ S2: can t ’ swim. ... under my bed.’ Thanks,Mom ! Trang 8Form : What s wrong? What s wrong? ’ ’I can t + ’ I can t + ’ V S1: What s wrong?’ S1: What s wrong?’ S2: I can t ’ S2: I can t ’ catch the ball. Dùng để hỏi

Ngày tải lên: 26/04/2021, 11:15

... thermally unstable 24 Benzothiophene and benzofuran are fascinating aryl rings because of their low aromatic stabilization energies 25,26 As another interesting aryl unit, indole can dramatically ... decoloration cycles of 1–3 could repeat 100 cycles with only ca 6% degradation of 1c, 8% degradation of 2c, and 12% degradation of 3c (Figure 3A) The degradation may be ascribed to the formation of ... promising candidates for practical applications because of their remarkable fatigue resistance, excellent thermal stability, and rapid response to the stimulation of light and chemicals 7−9 In the past

Ngày tải lên: 12/01/2022, 23:54

... in Valley, Alabama His father, Willard W Scott, was an electrician and later a minister His mother, Katheryne Sorrell Scott, was a homemaker and amateur musician His parents and grandparents were ... musical and came from musical families, particularly his mother’s 4 My father played the mandolin and fiddle and was part of a country and western band during the early years of his marriage On ... and amplify the text's meaning Embracing the enigmatic nature of creativity is essential, a concept that the romantics readily accepted In contrast, a more analytical approach tends to strip away

Ngày tải lên: 20/10/2022, 14:50

... covariance among traits [20, 21] Accordingly, although less common,assessment of a broad range of plant traits can deepen insights into possible trait limitations and tradeoffs associated with ... principal component analysis(PCA; via the function prcomp) and permutational multivariate analysis of variance (PERMANOVA; via thefunction adonis) separately for the following three categories of ... observed in data recorded at night (Figs. 4c and 4d) A linear model ofwithin-cone temperature as a function of air temperature, with sensor type as an additive covariate, showed that daytime mean thermocouple

Ngày tải lên: 01/11/2022, 23:22

... Takahashi T, Saikawa Y, Kitagawa Y (2013) Gastric cancer: current status of diagnosis and treatment Cancers 5:48–63 4 Yoshikawa T, Sasako M, Yamamoto S et al (2009) Phase II study of neoadjuvant ... mean ± standard deviation Ordinal variables are reported as median (range) Comparisons of all variables between MEIs, AMEIs and PEIs were performed Comparisons of visibility and stage migration ... visibility and stage migration of EGC for all three image data sets were evaluated and statistically ana-lyzed The objective and subjective image qualities were also evaluated Results AMEIs at 40

Ngày tải lên: 24/11/2022, 17:46

... being aware of air pollution, people in an industrial area of India did not feel it was a matter of concern because of other problems they faced (Bladen and Karan 1976). However differences across ... Press of Colorado Keown C F. 1989 Risk Perceptions of Hong Kongese vs. Americans Risk Analysis 9(3): 401-405 Koushki P A, Al-Fadhala S, Al-Saleh O, and Aljassar A H. 2002 Urban air pollution ... at the Department of Urban And Regional Planning, University of Hawai`i at Manoa. He has a Ph.D. in Environmental Science and Engineering from the Indian Institute of Technology Bombay, India....

Ngày tải lên: 06/03/2014, 16:20

... topology with six b-strands (bAtobF) and two a- helices (aA and aB) (Fig. 4). The structure of the C378G variant of SAP97 PDZ2 was practically identical to that of C378S variant, except for the mutated ... 890–907) of GluR -A and of two variant PDZ2 domains in unliganded state at 1.8–2.44 A ˚ resolutions. SAP97 PDZ2 folds to a compact globular domain comprising six b-strands and two a- helices, a typical ... that trans- genic mice expressing GluR -A variant lacking seven C-terminal residues display apparently normal synaptic plasticity and basal GluR -A localization [10], suggest- ing developmental...

Ngày tải lên: 30/03/2014, 10:20