... GeneSapiens database Data analysis All data analysis was done with R [25] Accuracy versus best similarity score The test samples were arranged according to the highest similarity score they had attained ... public domain, extracted from the GeneSapiens database [23] This approach has the advantage of improving constantly as more data are acquired and as algorithms are optimized This also allows more ... types, each class having an average of 100 samples per class, with a minimum of 6 (Additional file 2) Less than 1% of the samples were metastases; we thus refer to the reference data as primary cancer
Ngày tải lên: 11/08/2014, 12:21
... data reveal that a relatively toxic anti-inflammatory drug, such as aminopterin, can be targeted with folic acid to inflammatory macrophages and thereby relieve inflammatory symptoms with greatly ... investigated the biological activities of EC0746, a FA-AMT conjugate designed to intracellularly deliver an AMT analog specifically via the FR The anti-inflammatory activity of EC0746 was evalu-ated ... remedially affect cytokine responses associated with macrophage activation, and that the observed anti-inflammatory action of EC0746 can be independent of anti-macrophage proliferation Assessment of
Ngày tải lên: 12/08/2014, 15:22
EXAMPLE OF BACHELOR THESIS TITLE WITH LENGTH OF TWO LINES
... 3 Another example of figure placement in your body of thesis and its label 16 Trang 9LIST OF TABLES 1 Example of table placement in your body of thesis and its label 12 2 Another example ... example of table placement in your body of thesis and its label 13 3 Another example of table placement in your body of thesis and its label 14 4 Another example of table placement in your ... body of your thesis Please check that your body of thesis consistency in term of font type, font size, spacing, and margin are maintained Table 2 Another example of table placement in your body of
Ngày tải lên: 06/06/2016, 14:31
Fruit Fly Vapour Heat Disinfestation for Vietnam fresh fruit: an example of technical cooperation experiences with JICA (20052008)
... Japan for 6 Vietnamese managers to learn about Plant Quarantine Administration (2005 and 2006) Trang 20 Commitment and performance of Vietnamese and Japanese counterparts. Japanese scientists ... disinfestation technique of fruit flies that complies with international standard to improve Vietnamese dragon fruits’ access to international market. Vietnamese staff trained to be capable of applying ... disinfestation technique of fruit flies that complies with international standard to improve access of Vietnamese dragon fruit to international market. Leading to Lift Japanese ban on imports of
Ngày tải lên: 27/06/2016, 20:26
DSpace at VNU: Direct production of highly conductive graphene with a low oxygen content by a microwave-assisted solvothermal method
... Japan) operated at an accelerating voltage of 12 kV Transmission electron microscope (TEM) images were obtained on a JEOL JEM-2010 TEM (JEOL Ltd., Tokyo, Japan) with an accelerating voltage of ... (XRD) characterization was obtained using a D/MAX Rint 2000 diffractometer model (Rigaku, Tokyo, Japan) with CuKα radiation (λ = 1.54178 Å, 40 kv, 200 mA) The Raman spectra were taken using a Jasco ... by a step process using expanded graphite (EG) as a starting material EG was subjected to solvothermal treatment, followed by microwave radiation The FLG had an average thickness in the range of
Ngày tải lên: 12/12/2017, 06:53
John wiley sons what can you do with a major in business (2005) yyepg lotb
... courses you can expect to take as a general busi-ness major You’ll also discover ways to tailor your education to helpyou land that dream job when you graduate—or, at the very least, anentry-level ... work and specifically disclaim all warranties, including without limitation warranties of fitness for a particular purpose No warranty may be created or extended by sales or promotional materials ... Insuranceand Risk Management, Legal Studies, Management, Managing ElectronicCommerce, Marketing, Marketing and Communication, Operationsand Information Management, Real Estate, Statistics, and
Ngày tải lên: 23/05/2018, 13:53
Development of transgenic indica rice with a chimeric cry2AX1 gene against leaffolder, cnaphalocrocis medinalis (Guenee)
... 453-461 Jayaprakash, S.P., Nandeesha, P., Sozhavendan, A.E., Naveenkumar, A., Illakiyapriya, A., Balakrishnan, N., Balasubramani, V., Singh, P.K., Sudhakar, D., Balasubramanian, P and Udayasuriyan, ... G Rajadurai 1 , S Varanavasiyappan 2 , N Balakrishnan 2 , V Udayasuriyan 2 , D Sudhakar 2 and N Natarajan 1* 1 Department of Agricultural Entomology, 2 Department of Plant Biotechnology, Agricultural ... Manikandan R., Sathish, S., Balakrishnan, N., Balasubramani, V., Sudhakar, D and Udayasuriyan, V 2014 Agrobacterium mediated transformat-ion of indica rice with synthetic cry2AX1 gene for resistance
Ngày tải lên: 21/05/2020, 21:48
Natural hybridization and asymmetric introgression at the distribution margin of two Buddleja species with a large overlap
... color was noted for each of the individuals Traits were analyzed with one-way ANOVA, where specie was treated as a fixed factor When variances within each taxon were equal, as determined by a Levene ... hypothesized as natural hybrids, and mostly occurred along a main road in the scenic area of Xishan B officinalis individuals can be found throughout the area, and certainly more than 500 individuals can ... Measurements and data analysis of morphological traits Three leaves from ten healthy individuals for each of the three taxa were sampled from Xishan Mountain and then taken to KBG for morphological measurements
Ngày tải lên: 26/05/2020, 21:31
Metal complexes of π-expanded ligands (4): Synthesis and characterizations of copper(II) complexes with a schiff base ligand derived from pyrene
... with the available experimental data from X-ray diffraction analysis [31] As a whole, there is a perfect harmony between the theoretical data and the experimental structure for the ground state ... are also parallel and their planes are separated by 1.94 Å, approximately 3 times as much as that in 4 Therefore, the dihedral angle between pyrene ring and the plane of N1-O1-O1i-N1i was measured ... N1-O1-O1i-N1i was measured at 34.9o, about 2 times as much as that in 4 (15.9o) Another notable point is that the plane of seven carbon atoms of the long alkyl chains of 2 is nearly parallel to pyrene
Ngày tải lên: 09/08/2020, 17:08
Abnormal expression of Pygopus 2 correlates with a malignant phenotype in human lung cancer
... 5′-GATCCCCGCGAAGGAAGTCA AATACTTTCAAGAGAAGTATT TGACTTCCTTCGC TTTTT-3′ and 5′-AGCTAAAAAGCGAAGGAAGTCA AATA C TTCTCTTGAAAGTATTTGACTTCCTTCGC GGG-3′; Sequence B, 5′-GATCCCCC ACAAGTCCCTT TCCTGGTTTCAAGAGAACCAGGAAAGGGACTTG ... and 5′-AGCTAAAAACACAAGTCCC TTTCCTGGTTCTCTTGAAACCAGGA AAGGGAC TTGTGGGG-3′; Sequence C, 5′-GATCCCCGGAGAT CCAGTCTGTCT ACTTCAAGAGAGTAGACAGAC TGGATCTCCTTTTT-3′ and 5′-AGCTAAAAAG GA GATCC AGTCTGTCACTCTCTTGAAGTAGACAGAC ... Liaoning, China), according to the manufacturer’s instructions Pri-mer sequences were: Pygo2-for: 5′-GAAGCGAAGGAAGTCAAATAC-3′; Pygo2-rev: 5′-GCACAGGACTGCCAAGGAA-3′; β-actin –for: 5′-AGAGCTACGAGCTGCCTGAC-3′;
Ngày tải lên: 05/11/2020, 05:49
slide 1 where’s the ball it’s in the bedroom is the lamp next to the bed yesit is is it under the bed noit isn’t kióm tra bµi cò a ball kióm tra bµi cò can you swim can you play with a yo yo
... you play with a yo-yo ? Can you do a puzzle? Can you hit the ball? Trang 4 Thursday,March 18 th 2010.UNIT4: LET S TALK LET S TALK. ’ ’ P51 +52: What s wrong? What s wrong? ’ ’ I.Vocabulary: ... wrong?’ S2: can t ’ S2: can t ’ catch the ball. S1: What s wrong?’ S1: What s wrong?’ S2: can t ’ S2: can t ’ read the book. S1: What s wrong?’ S1: What s wrong?’ S2: can t ’ S2: can t ’ swim. ... under my bed.’ Thanks,Mom ! Trang 8Form : What s wrong? What s wrong? ’ ’I can t + ’ I can t + ’ V S1: What s wrong?’ S1: What s wrong?’ S2: I can t ’ S2: I can t ’ catch the ball. Dùng để hỏi
Ngày tải lên: 26/04/2021, 11:15
Synthesis and photochromism of new asymmetrical diarylethenes with a variable heteroaryl ring and a quinoline unit
... thermally unstable.24 Benzothiophene and benzofuran are fascinating aryl rings because of their low aromatic stabilization energies.25,26 As another interesting aryl unit, indole can dramatically ... promising candidates for practical applications because of their remarkable fatigue resistance, excellent thermal stability, and rapid response to the stimulation of light and chemicals.7−9 In the past ... 3A and 3B In acetonitrile, the coloration and decoloration cycles of 1–3 could repeat 100 cycles with only ca 6% degradation of 1c, 8% degradation of 2c, and 12% degradation of 3c (Figure 3A)
Ngày tải lên: 12/01/2022, 23:54
The Choral Music of Keaton Lee Scott With A Conductor-s Analysis
... in Valley, Alabama His father, Willard W Scott, was an electrician and later a minister His mother, Katheryne Sorrell Scott, was a homemaker and amateur musician His parents and grandparents were ... musical and came from musical families, particularly his mother’s 4 My father played the mandolin and fiddle and was part of a country and western band during the early years of his marriage On ... works of Alabama native William Dawson and Shaw-Parker arrangements, as well as the spirituals he encountered during his upbringing in the South Many of Scott's spiritual arrangements feature a strophic
Ngày tải lên: 20/10/2022, 14:50
A-Method-for-Experimental-Warming-of-Developing-Tree-Seeds-With-A-Common-Garden-Demonstration-of-Seedling-Responses
... observed in data recorded at night (Figs. 4c and 4d) A linear model ofwithin-cone temperature as a function of air temperature, with sensor type as an additive covariate, showed that daytime mean thermocouple ... principal component analysis(PCA; via the function prcomp) and permutational multivariate analysis of variance (PERMANOVA; via thefunction adonis) separately for the following three categories of ... covariance among traits [20, 21] Accordingly, although less common,assessment of a broad range of plant traits can deepen insights into possible trait limitations and tradeoffs associated with
Ngày tải lên: 01/11/2022, 23:22
Decreased stage migration rate of early gastric cancer with a new reconstruction algorithm using dual energy CT images: a preliminary study
... Takahashi T, Saikawa Y, Kitagawa Y (2013) Gastric cancer: current status of diagnosis and treatment Cancers 5:48–63 4 Yoshikawa T, Sasako M, Yamamoto S et al (2009) Phase II study of neoadjuvant ... and stage migration of EGC for all three image data sets were evaluated and statistically ana-lyzed The objective and subjective image qualities were also evaluated Results AMEIs at 40 keV showed ... mean ± standard deviation Ordinal variables are reported as median (range) Comparisons of all variables between MEIs, AMEIs and PEIs were performed Comparisons of visibility and stage migration
Ngày tải lên: 24/11/2022, 17:46
prediction of mirna disease associations with a vector space model
... miRNAs that are associated with a large amount of data What is more surprising is that the method perform equally well for diseases that are associated with only a few miRNAs The average AUC value ... Combination of matrices The matrices contain different types of data that are represented by real values that range from 0 to 1 A large matrix X that gathers all of the data available regarding ... false associations For diseases that are associated with many miRNAs, the inclusion of possibly false associations has an impact on the performance For example, the miRNAs that are associated with
Ngày tải lên: 04/12/2022, 15:53
PUBLIC PERCEPTIONS OF URBAN AIR POLLUTION WITH A FOCUS ON DEVELOPING COUNTRIES potx
... Saksena Sumeet Saksena is a Fellow in the Research Program at the East-West Center He is also Affiliate Faculty at the Department of Urban And Regional Planning, University of Hawai`i at Manoa ... physical data for a variety of air pollutants and weather indicators and, more importantly, for a variety of averaging times and tested the correlation with indicators of perceived and desired air ... that environmental quality is no longer seen as a post-materialist value and that environmental degradation is increasingly recognized as a direct threat to human health and welfare (Dunlap, Gallup...
Ngày tải lên: 06/03/2014, 16:20
Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt
... GluR -A and AMPA receptor mediated synaptic currents [16] SAP97 may also play a role in the endocytosis of GluR -A AMPA receptors, based on identification of a ternary complex between SAP97, GluR -A and ... topology with six b-strands (bA to bF) and two a- helices (aA and aB) (Fig 4) The structure of the C378G variant of SAP97PDZ2 was practically identical to that of C378S variant, except for the mutated ... et al Table Data collection and processing statistics Data set Space group Unit cell parameters a b c a b c ˚ Wavelength (A) ˚ Resolution (A) a Completeness (% )a Redundancya Rmergea,b I ⁄ SAP97PDZ2...
Ngày tải lên: 30/03/2014, 10:20
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc
... G *A* GCTGCACGCTGCCG*T*C GGCGGATCGGGTGTGTCAGC CCACTGGCTTCTGTCATAGT GAAGTCCAGGCCCAGTTTGA TCAATTAAGTAGGGCAGATT TCTCCAAAACGTCCACACGA ACAAAGCATGATGAGCTGCA GAGTAGAGCTTCATCTTCTC ACTGGTCAAGAATGTCATAA CAGGTTTGGGAAGGCGTCCA ... CCATGCCTATGATACTGGGAT-3¢ GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢ GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢ GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢ GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢ ... ACTGGTCAAGAATGTCATAA CAGGTTTGGGAAGGCGTCCA CAGGCCCTCAAACCGAGCCA GTCTGGACTTTGTGGTGCTA GGCATGACTGGGGTGAGGTT AAAATCAGTGAGGGAAGGGT TCTAATCTCTCAGGCCAGGC GCAGCTCCCCCACCAGGAAC Unrelated GFP–CDS CDS CDS CDS...
Ngày tải lên: 31/03/2014, 15:20
what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)
... Essentially, that means you are 12 What Can You Do with a Major in Biology? choosing one primary area of study as well as a secondary specialty This will appear on your transcript when you graduate ... Social Studies years years years years Math* years years years years Lab Science** years years years years Foreign Language years years years years Academic Electives years years years years ... personal essay allows each applicant to help admission officers read the map more accurately In addition to speaking of your goals, dreams, and expectations, you can explain any gaps or changes...
Ngày tải lên: 01/06/2014, 10:54
Bạn có muốn tìm thêm với từ khóa: