example of design and characterization of a specific protein protein interaction

Báo cáo y học: "The Proteomic Code: a molecular recognition code for proteins" docx

Báo cáo y học: "The Proteomic Code: a molecular recognition code for proteins" docx

... this variant as an artifact, caused by the symmetry of many codons Only a small percentage codon and amino acid pairs belongs to PC1; ~50% of all amino acid pairs and >60% of all codon pairs can ... that may be of interest Example Example of design and characterization of a specific protein- protein interaction The BacterioMatch™ two-hybrid system (Stratagene, 11011 N Torrey Pines Road, La ... regard to hydropathy and that the exact pattern of polar and non-polar amino acids, rather than the precise identity of particular R groups, is an important driver for protein shape and interactions...

Ngày tải lên: 13/08/2014, 16:21

44 418 0
Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx

Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx

... TGTAAAG TGTAAAG + ) + )95 )1100 )1470 ACACacG ACACttG ACACaaG + + + + ) ) ) ) ) )140 )1100 )1596 )1632 )140 )1100 )1596 )1632 )1874 CAaaTG CAagTG CAaaTG CAaaTG CAaaTG CActTG CAttTG CAgtTG TGAGTCA ... peptide was constructed as follows The DNA fragment was amplified from GmPDIM cDNA by PCR using the primers 5¢-GACGACGACAAGATGC ACGCACTCTATGGAGC-3¢ and 5¢-GAGGAGAAGC CCGGTTCATAGCTCATCCTTGCTTGAAG-3¢ ... with a Thermal Cycler DiceÔ Real Time System (TaKaRa Bio Inc.) The forward primer 5¢-CGGAACCAAAACATGC TAACATTTTC[FAM]G-3¢ (Invitrogen, Carlsbad, CA, USA) and the reverse primer 5¢-CGTTACAGGCAACTTGTTTCTCA-3¢...

Ngày tải lên: 30/03/2014, 04:20

12 350 0
Báo cáo hóa học: "Reference values and physiological characterization of a specific isolated pig kidney perfusion model" doc

Báo cáo hóa học: "Reference values and physiological characterization of a specific isolated pig kidney perfusion model" doc

... the x, y data are transformed into logarithmic scaling and linear lines instead of curves are resulting for constant values of the creatinine clearance In that way figure was constructed and the ... special grapho-analytical method (figure 1) This separating analysis is crucial since the Clcrea is commonly used as the approximation of the glomerular filtration rate and thus can be taken as ... solution) was driven by a roller pump The dialysate circuit meets the metabolic demands of the organ and, therefore, is permanently oxygenated and nutritional substrates are added as well as cre- Table...

Ngày tải lên: 20/06/2014, 00:20

13 549 0
Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

... Rogers et al designing analog and digital ASICs for wireless and satellite communications From 2000 to 2001, he was with YAFO Networks, Hanover, Maryland, where he was a Technical Manager and a Principal ... normally a commercially available part and data on its phase noise performance is often available from the manufacturer The ΣΔ phase noise can be estimated from (24) Note that the maximum fractionality ... all CMOS It was designed for multiband WLAN applications, and had a reference frequency of 40 MHz, a fairly standard charge pump and PFD configuration with gain Kphase of 750 A/ 2π, a multimodulus...

Ngày tải lên: 22/06/2014, 22:20

11 417 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

... Dutta P, Bhattacharya SK, Krishnan T, Kobayashi N, Naik TN: Genetic variability of human rotavirus strains isolated from Eastern and Northern India J Med Virol 2004, 72:156-161 Rahman M, Sultana ... 2001:1747-1785 Martella V, Ciarlet M, Baselga R, Arista S, Elia G, Lorusso E, Banyai K, Terio V, Madio A, Ruggeri FM, Falcone E, Camero M, Decaro N, Buonavoglia C: Sequence analysis of the VP7 and VP4 ... nucleotide mutation at the 3' end of the primer binding site Arch Virol 1997, 142:1881-1887 Taniguchi K, Wakasugi F, Pongsuwanna Y, Urasawa T, Ukae S, Chiba S, Urasawa S: Identification of human and bovine...

Ngày tải lên: 20/06/2014, 01:20

4 330 0
Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc

Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc

... F, Vieta E, Martínez-Arán A, Garcia-Garcia M, Reinares M, Torrent C, Goikolea JM, Banús S, Salamero M: Spanish version of a scale for the assessment of mania: validity and reliability of the ... Juan José Uriarte, and Fermín Mayoral for their contribution in the linguistic validation Author details Department of Psychiatry, Hospital Universitario de Salamanca, Salamanca, Spain 2Department ... BMS-Otsuka, GSK, Sanofi, Astra Zeneca, Boehringer and Wyeth Fees from Lilly, BMS-Otsuka, GSK, Sanofi, Astra Zeneca, Montejo et al Annals of General Psychiatry 2011, 10:6 http://www.annals-general-psychiatry.com/content/10/1/6...

Ngày tải lên: 09/08/2014, 01:21

8 477 0
Báo cáo y học: "Association of a specific haplotype across the genes MMP1 and MMP3 with radiographic joint destruction in rheumatoid arthritis" ppt

Báo cáo y học: "Association of a specific haplotype across the genes MMP1 and MMP3 with radiographic joint destruction in rheumatoid arthritis" ppt

... It evaluates 38 joints separately (all proximal interphalangeal and metacarpophalangeal joints, four sites in the wrists, interphalangeal joints of the great toes, and metatarsophalangeals to ... investigator (RR) who was unaware of the results of the genetic analyses At the Rheumaklinik Ratingen, radiographs of both hands and feet are routinely obtained for all RA patients at disease onset and ... the Materials and methods section RR and GH took care of all patients They collected clinical data and all blood samples and radiographs and scored them by means of the Ratingen score UW carried...

Ngày tải lên: 09/08/2014, 01:23

9 358 0
Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

... the maintenance of synovial inflammation, aggravating the destruction of cartilage and bone and stimulating the development of the pannus Because FLSs can exhibit significant phenotypic changes ... tissue.(b) Intense staining of the synovial lining layer and perivascular regions of OA (paraffin section) tissue (c) An area demonstrating a thin lining layer and perivascular region populated with c19orf10-positive ... Diego, CA, USA), resulting in a glutathione S transferase (GST)-His-c19orf10 fusion gene Primers Orf10NdeI (gaattccatatGGTGTCCGAGCCCACGA) and Orf10R2 (catggctcgagcAGCTCAGTGCGCGAT) were used to amplify...

Ngày tải lên: 09/08/2014, 10:20

9 493 0
báo cáo khoa học: "Design and characterization of protein-quercetin bioactive nanoparticles" doc

báo cáo khoa học: "Design and characterization of protein-quercetin bioactive nanoparticles" doc

... globular proteins: A nuclear magnetic relaxation dispersion study Protein Sci 1997, 6:1756-1763 Paramaguru G, Kathiravan A, Selvaraj S, Venuvanalingam P, Renganathan R: Interaction of anthraquinone ... experimental data The concentration of BSA (A and B), Lys (A and B’), or Mb (A ’ and B’’) were 1.5 × 10-5 mol/L (A) , (A ), and (A ’) Comparison of the fitting results of the dynamic, static and simultaneous ... spectra of BSA, Lys, and Mbsystem The concentration of (A and B) BSA, (A and B’) Lys, or (A ’ and B’’) Mb was 1.5 × 10-5 mol/L (A) , (A ), and (A ’) Effects of DMSO at 27°C (B), (B’), and (B’’)...

Ngày tải lên: 11/08/2014, 00:23

14 294 0
Design and characterization of functional novel oligopeptides

Design and characterization of functional novel oligopeptides

... post-docs, Dr Parayil Kumaran Ajikumar and Dr Lakshminarayanan Rajamani, in their helpful and invaluable advice and encouragement during the course of my research I would also like to extend my gratitude ... purification and characterization of the target peptide Various chemical strategies exist for the chain assembly and cleavage/deprotection operations, but purification and characterization methods are ... 51 at pH ~ and Figure 12 AFM images of P3 adsorbed onto mica substrate from water 53 at pH ~ and Figure 13 AFM images of P4 adsorbed onto mica substrate from water 55 at pH ~ and Figure 14 AFM...

Ngày tải lên: 04/10/2015, 10:25

95 275 0
Design and characterization of interposers for high speed fine pitch wafer level packaged device testing

Design and characterization of interposers for high speed fine pitch wafer level packaged device testing

... research iii I am also grateful to my NWLP project team Special thanks go to Prof Andrew Tay, Prof David Keezer and Prof Rao Tummala for their help and support Lastly, I would like to thank my family ... properties of an ideal transmission line can be approximated with combinations of inductors (L) and capacitors (C), the behavior of an ideal transmission line matches the actual, measured behavior of ... the design Simulations results are analyzed and discussed at the end of the chapter Chapter 4: Design, fabrication and characterization of the proposed elastomer based interposer are presented...

Ngày tải lên: 04/10/2015, 10:25

126 204 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... Electrophoretic analysis and purification of recombinant ASP3c (A) SDS/PAGE analysis of recombinant ASP3c secreted by Pichia pastoris Lane shows standards (Low range and Polypeptide kits, Bio-Rad, France) and ... brassicae CSPMbraA6 [32] We observed also that BrC15-Ac was able to displace ASA, suggesting that brominated fatty acid and ASA both associated with W81 in the same ligand binding site The ligand ... Nomura, A. , Kawasaki, K., Kubo, T & Natori, S (1992) Purification and localization of p10, a novel protein that increases in nymphal regenerating legs of Periplaneta americana (American cockroach)...

Ngày tải lên: 21/02/2014, 03:20

11 642 0
Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

... damage before it is dephosphorylated If this is the case, removal from the action of the ataxia telangiectasia mutated (ATM) ⁄ ataxia telangiectasia and RAD53 related (ATR) kinases at the site of ... site of DNA damage may decrease the kinase ⁄ phosphatase ratio and allow the phosphatase to dephosphorylate cH2AX In mammalian cells, PP 2A isoforms, the orthologues of S cerevisiae Pph21p and Pph22p, ... treatment and following removal of MMS after recovery for 2, and h cH2AX is believed to play a central role in the recruitment and ⁄ or retention of DNA repair factors at the sites of DNA damage...

Ngày tải lên: 30/03/2014, 04:20

11 362 0
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

... that associates with nuclear matrix DNA Cell Biol 17, 849–858 Lee JY, Nakane Y, Koshikawa N, Nakayama K, Hayashi M & Takenaga K (2000) Characterization of a zinc finger protein ZAN75: nuclear ... E B A A A A A A A A C A B D A A A A B A 71 47 217 42 S S M S 1 – – – 25 – B A C A 67 130 160 98 S S M M – – – 13 30 A A B B Accession no in the NCBI protein database proteins Filamentous proteins ... Thanumalayan S, Muralikrishna B, Rangaraj N, Karande AA & Parnaik VK (1999) Colocalization of intranuclear lamin foci with RNA splicing factors J Cell Sci 112, 4651–4661 11 Gueth-Hallonet C, Wang...

Ngày tải lên: 30/03/2014, 20:20

12 401 0
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

... 72 years, and the mean age was 45.6 years (SD = 9.4) Regarding academic rank, 15% of researchers were non-academic members, 7% were instructors, and 33%, 26%, and 19% were assistant, associate, ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... transfer activities as equal weight for various cases is a simple and optional approach Linear regression analysis was done by entering all variables into the model This type of analysis was...

Ngày tải lên: 11/08/2014, 05:21

8 344 0
báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

... 72 years, and the mean age was 45.6 years (SD = 9.4) Regarding academic rank, 15% of researchers were non-academic members, 7% were instructors, and 33%, 26%, and 19% were assistant, associate, ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... transfer activities as equal weight for various cases is a simple and optional approach Linear regression analysis was done by entering all variables into the model This type of analysis was...

Ngày tải lên: 11/08/2014, 16:21

8 322 0
Magnetic resonance spectroscopy correlation with histological analysis in gliomas and structure determination of a hypothetical protein

Magnetic resonance spectroscopy correlation with histological analysis in gliomas and structure determination of a hypothetical protein

... physiologically relevant range Most studied metabolites in brain are Acetate, N-Acetyl aspartate (NAA), N-Acetylaspartylglutamate (NAAG), Alanine, Choline, Creatine, Glutamate, Glycine, Myo-inositol, Lactate, ... and activity in brain All these facts, loss of NAA, presence of acetate and absence of mono-sacchride and myo-inositol of sample NNI1, indicate that the major activities and primary functions of ... sequences can be applied At the same time, advanced computers and workstations are capable of controlling experiments and various powerful softwares make it easier and faster to analyze spectra Furthermore,...

Ngày tải lên: 10/11/2015, 11:35

92 287 0
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc

Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc

... K., Takahashi, M., Sekine, M., Baba, S., Ankai, A. , Kosugi, H., Hosoyama, A. , Fukui, S., Nagai, Y., Nishijima, K., Otsuka, R., Nakazawa, H., Takamiya, M., Kato, Y., Yoshizawa, T., Tanaka, T., ... Thermoplasma volcanium Proc Natl Acad Sci USA 97, 14257–14262 49 Kawarabayasi, Y., Hino, Y., Horikawa, H., Yamazaki, S., Haikawa, Y., Jin-n., o, K., Takahashi, M., Sekine, M., Baba, S., Ankai, A. , ... with a linear gradient (0/0.3 M NaCl) in 30 at a flow rate of 0.5 mLÆmin)1 A single peak was observed on RP-HPLC and a single protein band on SDS/PAGE Analytical methods for protein characterization...

Ngày tải lên: 16/03/2014, 16:20

12 510 0
w