... patients on antimicrobial and other therapies that can alter the balance of the gut microbiota (for example, antacid/pro-ton pump inhibitors and non-steroidal anti-inflammatory drugs), but also ... hospital, Buckinghamshire, marked the arrival of the epidemic 027 isolates to the UK Between April 2003 and March 2006 a total of 498 patients acquired C dif-ficile at the hospital (measured ... glycosyl transferase (family 2), two putative uncharacterized proteins, a putative carbamoyl-phosphate-synthetase and a putative ornithine cyclodeami-nase (Figure 3) The variation in the F1 region
Ngày tải lên: 09/08/2014, 20:20
... Calyptratae is not available At the onset of my thesis, I assessed what is known based on the available data The reconstruction of phylogenies of large groups like the Calyptratae can be approached ... the available datasets was poor, adding more data into a supermatrix of taxa from across the calyptrate group was regarded as the most appropriate approach This is the technique that I have used ... molecular markers Chapter 2: Sensitivity analysis, molecular systematics, and natural history evolution of Scathophagidae (Diptera:Calyptrate: Musocidea) Chapter 3: The Muscoidea (Diptera:Calyptratae)
Ngày tải lên: 12/09/2015, 09:21
Untethered employees the evolution of a wireless workplace
... performance areas? Please rate on a scale from “Well above average” to “Well below average” (% respondents) Well above average Somewhat above average Average/on par with peers Somewhat below average ... IT and technology 11 Singapore, Switzerland Healthcare, pharmaceuticals and biotechnology Brazil, China, Germany, Italy, Malaysia, New Zealand, Nigeria, Spain Manufacturing Belgium, Bulgaria, ... employees: The evolution of a wireless workplace Mobility is changing our work practices and pushing them towards new modes of interactivity and collaboration The landscape of the workplace has changed
Ngày tải lên: 04/12/2015, 00:19
[15588432 - Journal of Applied Meteorology and Climatology] Synoptic to Microscale Processes Affecting the Evolution of a Cold-Air Pool in a Northern New England Forested Mountain Valley
... at the top of the CAP, initial variation in the height of the CAP (Fig 3a), and the warming of the upper 75 m of the vertical profile indicate that the westerly wind and associated WAA began ... radiatively cool while the upper part of the CAP was warmed and eroded by the WAA Results suggest that the canopy acts as the primary cooling surface for air at night, which causes split katabatic ... Interactions between cold-air pools (CAPs) and the atmosphere above can act to strengthen or erode the CAP, affecting surface temperatures and transport of hazardous pollutants CAPs, quasi-stagnant
Ngày tải lên: 27/10/2022, 14:59
Báo cáo khoa học: Directed evolution of a histone acetyltransferase – enhancing thermostability, whilst maintaining catalytic activity and substrate specificity doc
... substrate specific- ity. P ⁄ CAF, p300 ⁄ CBP-associating factor, is a trans criptional coactivator with a variable N-terminal, a central HAT domain and a C-terminal bromodomain. Several stabilizing ... which was given a value of 1.0. Fig. 6. Location of thermostabilizing mutations. Cartoon represen- tation of the catalytic domain of P ⁄ CAF (crystal structure 1CM0 of the Protein Data Bank) [34]. ... proteins, whilst retaining their catalytic capacity. In the present study, we have shown that mutations stabilizing the catalytic domain of the human histone acetyltransfer- ase P ⁄ CAF are readily identified
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: Directed evolution of a glutaryl acylase into an adipyl acylase potx
... com-pared to a calibration curve of 7-ACA or 7-ADCA, respectively 1.2 mMGlutaryl-7-ACA was used as substrate for the analysis of fractions during the purification For the determination of Vmax and ... hand, the mutants are not improved in catalysis of glutaryl-7-ACA as shown by the lower kcatof all mutants and the lower affinity of mutant Y178H for the glutaryl substrate A parameter to compare ... highly active adipyl acylase is needed for deacylation of the adipyl derivative Such an adipyl acylase can be generated from known glu-taryl acylases The glutaryl acylase of Pseudomonas SY-77 was
Ngày tải lên: 31/03/2014, 09:20
John h foote clint eastwood ~ evolution of a filmmaker
... He drank heavily, and by thetime he came to Eastwood he had a reputation as an alcoholic Eastwood waswell aware of the actor’s drinking as well as the ravages of the disease on theactor’s good ... character, the arc of the performance, and the motivation ofthe characters Eastwood, believing in her as an actress, gave her the role Shethen began her research into the character, with Eastwood taking ... national by insulting awoman who has contacted Dave about his program, and when Dave man-ages to get her into a cab after a terrible physical altercation, she screams athim as the taxi pulls away,
Ngày tải lên: 20/07/2016, 10:45
Phenotypic and genetic characterization of a cohort of pediatric wilson disease patients
... tyghaffar@gmail.com 1 Yassin Abdel Ghaffar Charity Center for Liver Disease and Research, Cairo, Egypt Full list of author information is available at the end of the article © 2011 Abdel Ghaffar ... stable or normal transami-nases and hepatic synthetic function and 24-hour urin-ary copper less than 500 μg/day D-PCA dose was gradually decreased and then maintained at a dose of ~10 mg/kg/day ... other studies [22] Again, the age of onset of patients with ALF in this cohort (median: 9 years) is less than generally reported In our cohort as well as that of Dhawn et al., there was a male
Ngày tải lên: 26/03/2020, 00:46
Knowledge and experience of a cohort of HIV-positive and HIV-negative Ghanaian women after undergoing human papillomavirus and cervical cancer screening
... in any way involved in the design of the study, collection, analysis, interpretation of data and writing of the manuscript. Availability of data and materials The datasets generated and/or analysed ... manuscript AA was involved in data collection, data analysis and drafting of the manuscript PM contributed to development of the research concept, data analysis and drafting of the manuscript All authors ... data analysis and drafting of the manuscript) YAS contributed to development of the research concept and drafting of the manuscript AHB was involved in data collection and drafting of the manuscript
Ngày tải lên: 23/09/2020, 11:53
Clinical variables serve as prognostic factors in a model for survival from glioblastoma multiforme: An observational study of a cohort of consecutive non-selected patients from a
... It can also be seen that a change in several variables at the same time can have a major negative impact on the survival probability for the individual patient, while a change in only one of the ... the entry level was 5% The analysis was repeated removing the least significant covariate in order to use all available data, in particular the molecular markers were only done for a subset of ... 046), and use of corticosteroid therapy at RT/TMZ initiation (P = 036) had a significant Table Univariate analysis of correlation of clinical variables with survival, disease progression, and response
Ngày tải lên: 05/11/2020, 06:04
Creation v evolution what the dr daniel a biddle
... is also a member of MENSA, a Fellow of the American Scientific Association, a member of The National Association for the Advancement of Science, and member of many other professional associations ... Sexism Professor Bergman has also taught at the Medical College of Ohio as a research associate in the Department of Experimental Pathology, at the University of Toledo, and at Bowling Green State ... several Creation-related publications Daniel has a Ph.D in Organizational Psychology from Alliant University in San Francisco, California, an M.A in Organizational Psychology from Alliant, and a B.S
Ngày tải lên: 15/05/2019, 16:53
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... envelope, such as the phosphate groups within the LPS molecules of the OM in Gram-negative bacteria or the lipoteichoic acids on the surface of Gram-posi-tive bacteria In the case of Gram-negaGram-posi-tive ... data not shown), the bacterial proteome was analyzed by means of 2D-PAGE and MS This analysis revealed a similar pattern of responses to both sublethal and lethal pep-tide doses, consisting of ... experiments have underscored the fact that Esc(1–18) possesses a wide spectrum of antimicrobial activity against several species of Gram-positive bacteria, Gram-negative bacteria, Candida and multidrug-resistant
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... suggests that C paradoxa PsbU has a higher homology with the red algal protein than with the cyanobacterial one The C paradoxa thylakoid membranes also contained a band cross-reacted with anti-(R-PsbQ¢), ... 8004–8012 4 Enami I, Murayama H, Ohta H, Kamo M, Nakazato K & Shen J-R (1995) Isolation and characterization of a photosystem II complex from the red alga Cyanidium caldarium: association of cytochrome ... likely that Prasinophytes also contain PsbQ The thylakoid membranes of P parkeae and E gracilis did not react with any antibodies against the red algal and cyanobacterial extrinsic proteins (lanes
Ngày tải lên: 23/03/2014, 15:21
Providing detailed guidelines for implementation of a number of articles of the law on enterprise
... conditions and method of certifying legal capital case of a limited liability company; the chairman of the board of management and the director (general director) in the case of a shareholding company; ... (general director) in the case of a limited liability company; the chairman of the board of management and director (general director) in the case of a shareholding company; all partners in the case ... this clause, then the criteria and conditions stipulated in the company charter shall apply company chairman, the chairman of the board of management and the director (general director) of any one
Ngày tải lên: 27/03/2014, 10:15
Đề tài " The two possible values of the chromatic number of a random graph " pot
... Annals of Mathematics The two possible values of the chromatic number of a random graph By Dimitris Achlioptas and Assaf Naor Annals of Mathematics, 162 (2005), 1335–1351 The two possible values ... This lemma is a variant of the classical Laplace method of asymptotic analysis in the case of the Birkhoff polytope Bk , i.e., the set of all k × k doubly stochastic matrices For a matrix A ∈ Bk ... references therein for accounts of many remarkable results on random graphs, as well as for their connections to various areas of mathematics In the present paper we consider random graphs of bounded average
Ngày tải lên: 29/03/2014, 07:20
báo cáo hóa học: " Bayesian bias adjustments of the lung cancer SMR in a cohort of German carbon black production workers" pdf
... uncertainty about the parameters after we have analyzed the observed data The goal of the analysis is to calculate how we should bet about the parameters after the data was observed and analyzed Therefore, ... para-meters and the observed data into account In summary, Bayesian bias analysis offers an analysis that adjusts the SMR (= target parameter) and estimates the uncertainty of the SMR by including a quantitative ... on CAREX data (Analyses 1 and 2) and a second based on data assessed by a German expert (Analyses 3 and 4) The proportion of male smokers in the population was estimated in all analyses by a representative
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " The evolution of human influenza A viruses from 1999 to 2006: A complete genome study" docx
... that new pandemics emerge through shifts with strains from the avian reservoir, as was the case of the pan-demics of 1957 and 1968, or by direct introduction of an avian strain into the human ... A/Denmark/07/03 A/Wyoming/03/03 A/Denmark/41/03 A/Denmark/52/03 A/Denmark/50/03 A/Denmark/56/03 A/Denmark/86/03 H1N2 A/Denmark/207/00 A/Denmark/208/00 A/Denmark/38/00 A/Denmark/204/00 A/Denmark/200/00 ... A/Wisconsin/67/05 A/Denmark/7/06 A/Denmark/112/06 A/Denmark/46/06 A/California/07/04 A/Denmark/200/05 A/Denmark/04/05 A/Denmark/68/05 A/Denmark/203/05 2004-2005 A/Denmark/13/06 A/Denmark/35/06 2005-2006 A/Denmark/83/05
Ngày tải lên: 20/06/2014, 01:20
Đề tài " Growth of the number of simple closed geodesics on hyperbolic surfaces " docx
... geodesics. A measured geodesic lamination is a geodesic lamination that carries a transverse invariant measure. Namely, a compactly supported measured geodesic lamination λ ∈ML g,n consists of a SIMPLE ... integral multi-curve. Calculation of c(γ) and b g,n . Now we can explicitly calculate the value of the integral of the function B over M g,n . Theorem 5.3. In terms of the above notation, we have: (1) ... section we use the ergodicity of the action of the mapping class group on the space of measured laminations to obtain the following results: Theorem 6.1. For any rational multi-curve γ and X ∈T g,n , s X (L,...
Ngày tải lên: 06/03/2014, 08:21
Đề tài "Stretched exponential estimates on growth of the number of periodic points for prevalent diffeomorphisms I " potx
... Lemma 4.4. From a brick of at most standard thickness to an admissible brick 4.5. The main estimate on the measure of “bad” parameters References 1. A problem of the growth of the number of periodic ... the main result for the 1-dimensional maps has another important feature: it clarifies the statement of the main multidimensional result. Fix the interval I =[−1, 1]. Associate to a real analytic ... produces the same measure whether the standard basis or Newton basis is used. Now we will estimate the measure of “bad” parameters for a particular trajectory using the Newton basis, without regard...
Ngày tải lên: 29/03/2014, 07:20
Bạn có muốn tìm thêm với từ khóa: