equations of the form y b k t 2 •••••••••••••••

Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

... ratio was obtained The < /b> results of < /b> 10 20 shots were averaged to obtain the < /b> final spectrum Enzyme assay The < /b> b- amylase activity was determined by different methods The < /b> first method was based on the < /b> ... Inhibition of < /b> the < /b> enzyme activity by glucose, maltose and cyclohexaamylose For the < /b> study of < /b> the < /b> enzyme inhibition by glucose, maltose and cyclohexaamylose b- amylase activity was measured using the < /b> ... the < /b> 26 to 28 -kDa polypeptides (together < 35% of < /b> the < /b> total protein) represent the < /b> unglycosylated and glycosylated form < /b> of < /b> the < /b> so-called CalsepRRP [14] N-terminal sequencing of < /b> the < /b> 55-kDa polypeptide...

Ngày tải lên: 22/02/2014, 07:20

11 613 0
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

... necessary not only to shed some light on the < /b> steps involved in the < /b> fibrillogenesis, but, most of < /b> all, to evaluate the < /b> role of < /b> Ab-(1– 42) in the < /b> interaction with the < /b> membrane The < /b> structure of < /b> Ab-(1– 42) ... not only to overcome the < /b> solubility problem, but also to try to simulate in some aspects the < /b> physico-chemical Fig Stereo view of < /b> the < /b> lowest energy structure colored according to the < /b> electrostatic ... feature of < /b> small and medium size peptides, but in the < /b> case of < /b> Ab the < /b> conformational flexibility is particularly interesting, as it can be related to its biological activity The < /b> choice of < /b> the < /b> solvent...

Ngày tải lên: 08/03/2014, 09:20

7 626 0
Báo cáo Y học: Role of conserved residues within helices IV and VIII of the oxaloacetate decarboxylase b subunit in the energy coupling mechanism of the Na+ pump ppt

Báo cáo Y học: Role of conserved residues within helices IV and VIII of the oxaloacetate decarboxylase b subunit in the energy coupling mechanism of the Na+ pump ppt

... that the < /b> Na+ binding of < /b> the < /b> decarboxylase (Km % mM) was dramatically affected by the < /b> S382A mutation We also investigated the < /b> stability of < /b> OadB with the < /b> S382A mutation in the < /b> presence of < /b> trypsin This ... ligand but is not involved in the < /b> proton pathway through the < /b> membrane For proton translocation the < /b> phenolic hydroxyl of < /b> Y2< /b> 29 appears to switch between the < /b> protonated and the < /b> deprotonated state The < /b> ... propose that carboxybiotin formed at the < /b> carboxyltransferase site of < /b> the < /b> enzyme switches to the < /b> decarboxylase site on OadB where it forms a stable complex, possibly with the < /b> side chain of < /b> R389, at the...

Ngày tải lên: 08/03/2014, 23:20

8 510 0
Báo cáo Y học: Engineering and mechanistic studies of the Arabidopsis FAE1 b-ketoacyl-CoA synthase, FAE1 KCS pot

Báo cáo Y học: Engineering and mechanistic studies of the Arabidopsis FAE1 b-ketoacyl-CoA synthase, FAE1 KCS pot

... activity Decarboxylation activity of < /b> His391A mutant protein was at the < /b> background level and H39 1K had decarboxylation activity that was slightly above that of < /b> the < /b> background (Table 1) Substitution ... acylation of < /b> the < /b> active site cysteine [24 ] In these studies, substitution of < /b> the < /b> active-site cysteine to alanine did not significantly reduce the < /b> decarboxylation activity of < /b> the < /b> chalcone synthase, thus ... the < /b> release of < /b> 14CO2 Yeast microsomes exhibited high rates of < /b> decarboxylation activity, such that the < /b> yeast control activity was equal to the < /b> decarboxylation activity of < /b> the < /b> microsomal FAE1 KCS...

Ngày tải lên: 24/03/2014, 03:21

9 462 0
Báo cáo Y học: Substrate selectivity and sensitivity to inhibition by FK506 and cyclosporin A of calcineurin heterodimers composed of the a or b catalytic subunit potx

Báo cáo Y học: Substrate selectivity and sensitivity to inhibition by FK506 and cyclosporin A of calcineurin heterodimers composed of the a or b catalytic subunit potx

... inhibition of < /b> CaN phosphatase activity toward the < /b> two peptide substrates by the < /b> CaN autoinhibitory peptide, and the < /b> FKBP 12/ FK506 complex The < /b> activation of < /b> CaN phosphatase activity towards pNPP by ... CnAa catalytic subunit [16 ,20 ,22 ,23 ] The < /b> results presented here are the < /b> first direct studies of < /b> the < /b> inhibition of < /b> CaN containing the < /b> CnAb catalytic subunit by FKBP 12/ FK506 or CyPA/CsA For both immunophilin/immunosuppressant ... affected by CnB, the < /b> interaction between CnA and CnB may affect how the < /b> FKBP 12/ FK506 and CyPA/CsA complexes affect the < /b> substrate-binding cleft Thus, both the < /b> catalytic subunit and substrate may...

Ngày tải lên: 24/03/2014, 03:21

9 474 0
Báo cáo y học: "Characterization of the human endogenous retrovirus K Gag protein: identification of protease cleavage sites" ppt

Báo cáo y học: "Characterization of the human endogenous retrovirus K Gag protein: identification of protease cleavage sites" ppt

... HERV -K has retained its capability to form < /b> viral particles, but there are no signs of < /b> infectivity Little is known about the < /b> biological function Table Summary of < /b> the < /b> sequences obtained from Nterminal ... 8 :21 http://www.retrovirology.com/content/8/1 /21 sequence motif The < /b> substrate must be in an extended conformation to fit into the < /b> active site to be hydrolyzed [20 ] Therefore, we identified the < /b> cleavage ... spots isolated by 2- D gel electrophoresis Kraus et al Retrovirology 20 11, 8 :21 http://www.retrovirology.com/content/8/1 /21 Page of < /b> Table Summary of < /b> the < /b> peptide fragments obtained by MS analysis...

Ngày tải lên: 13/08/2014, 01:20

8 209 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...

Ngày tải lên: 16/02/2014, 09:20

20 693 0
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

... residues of < /b> IC initially attract the < /b> inhibitor to the < /b> membrane surface, and that the < /b> membrane–protein interactions are then further stabilized by short-range specific interactions, resulting in the < /b> ... subsequently sorted into the < /b> lumens to regulate the < /b> vacuolar CPY activities through complex formation with the < /b> cognate protease The < /b> interaction of < /b> IC with the < /b> yeast Ras GTPase-activating protein, ... affinity and specificity (Table 2) clearly A suggest that the < /b> CPY-binding sites [8] and the < /b> phospholipid recognition site of < /b> IC overlap, and that the < /b> N-terminal segment at the < /b> CPY-binding sites participates...

Ngày tải lên: 19/02/2014, 05:20

10 647 1
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

... crystallographically trapped intermediate in the < /b> transition between the < /b> T- and R-states Later modeling studies have argued that the < /b> R2-state was actually the < /b> endpoint of < /b> the < /b> transition from the < /b> T- state The < /b> crystallization, ... ; bO2 ÞðaO2 ; bO2 Þ À ða; bO2 ÞðaO2 ; bO2 Þ þ O2 ka À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! hv ð1Þ ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À ðaO2 ; b ðaO2 ; bO2 Þ þ O2 ! kb À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! where (aO2, bO2)(aO2, ... with dimer to the < /b> total protein oxygenation must be taken into account and the < /b> effect of < /b> NaCl concentration on the < /b> rates of < /b> O2 binding to the < /b> a and b subunits within the < /b> dimer must be found It...

Ngày tải lên: 16/03/2014, 14:20

11 578 0
Báo cáo khoa học: Characterization of the lipopolysaccharide and b-glucan of the fish pathogen Francisella victoria ppt

Báo cáo khoa học: Characterization of the lipopolysaccharide and b-glucan of the fish pathogen Francisella victoria ppt

... observation of < /b> the < /b> weak C-5: H -2 HMBC correlation There was no data for the < /b> determination of < /b> the < /b> configuration of < /b> chiral atoms Taken together, these experimental data agreed with the < /b> structure (Fig ... been shown to be immuno-stimulatory, whereas at higher concentrations they can be immuno-inhibitory [20 ,21 ] and seem to modulate the < /b> release of < /b> potent cytokines induced by LPS Possibly the < /b> starch-like ... (F) F Victoria regarding the < /b> structure of < /b> the < /b> most obscure region between Fuc R and Fuc L (data not shown) After the < /b> determination of < /b> the < /b> structure of < /b> the < /b> product 3, the < /b> full sequence of < /b> the < /b> oligosaccharides...

Ngày tải lên: 30/03/2014, 10:20

12 399 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

... present study, we noticed that with the < /b> exception of < /b> the < /b> pancreas and the < /b> skin, in rat organs, the < /b> A and B antigens never codistributed at the < /b> cellular level It is unlikely that mAb ED3, the < /b> anti -B ... B antigens, the < /b> cellular distribution of < /b> the < /b> two antigens is not always identical (see text for details) The < /b> labeling by the < /b> anti-A antibody was the < /b> same on paraffin embedded sections, but no B ... indicated in Table A strong signal was obtained in the < /b> oesophagus, the < /b> stomach, the < /b> colon, the < /b> Table Tissue distribution of < /b> the < /b> Abo mRNA and of < /b> the < /b> A and B antigens in the < /b> BDIX rat Transcripts were...

Ngày tải lên: 31/03/2014, 09:20

8 500 0
cognitive psychology in and out of the lab. 4th ed.  -  k. galotti (wadsworth, 2008)

cognitive psychology in and out of the lab. 4th ed. - k. galotti (wadsworth, 2008)

... work by touch alone Sometimes pilots retracted their landing gear instead of < /b> putting on their brakes; they touched the < /b> ground with the < /b> belly of < /b> the < /b> plane at top speed The < /b> best way to keep them ... 127 Automaticity and the < /b> Effects of < /b> Practice 128 The < /b> Stroop Task 128 Divided Attention 137 Dual-Task Performance 137 The < /b> Attention Hypothesis of < /b> Automatization 139 The < /b> Psychological Refractory ... seems to be confusing the < /b> length of < /b> the < /b> row with the < /b> numerosity of < /b> the < /b> row In other words, a typical child of < /b> this age regards the < /b> number of < /b> buttons as being the < /b> same thing as the < /b> length of < /b> the...

Ngày tải lên: 12/05/2014, 17:34

705 1,4K 0
Báo cáo toán học: "A Note on the Asymptotic Behavior of the Heights in b-Tries for b Large" ppt

Báo cáo toán học: "A Note on the Asymptotic Behavior of the Heights in b-Tries for b Large" ppt

... b) j e 2 k = 2 i log (b! ) 2k b log (2 k ) e z j−1 exp − 2k log − 2 i b z2 k [1 + O (b8 k z 2 )]dz tj−1 e1 /t [1 + O (2 k b 1 t 2 + 2 k t 2 )]dt n! k j − 2k log (b! ) 2k b log (2 k ) (4 b) e e [1 + O(j 2 k ... point at B = −a and a standard application of < /b> the < /b> steepest descent method yields n! e−a /2 k k ∼ √ e2 b2 kn 2 k/ 2 e 2 a /2 exp − √ 2k 2 a 2 bn b hk n But in this limit we have n! 2k b −kn ... e ∼ bn n b2 k n√ k b n 2 ne2 (A .2) the < /b> electronic journal of < /b> combinatorics (20 00), #R39 15 √ a n 2k √ba 2 n − √ e b √ √ n n ∼ 2 n exp 2k b − √ a − a2 2b b √ a ∼ 2 b2 k/ 2 exp 2k = Using the < /b> above...

Ngày tải lên: 07/08/2014, 06:20

16 353 0
Báo cáo lâm nghiệp: "Influence of the form of nitrogen nutrition reductase activity in young black locus" doc

Báo cáo lâm nghiệp: "Influence of the form of nitrogen nutrition reductase activity in young black locus" doc

... with the < /b> advent of < /b> the < /b> N activity, indicates a relationship ase between both enzyme activities The < /b> low NR activity (!1 nmol N0 DW!h-!) of < /b> -mg2 nodulated plants could be greatly increased by nitrate ... expanded, the < /b> NR activity decreased in the < /b> previous leaf and the < /b> highest enzyme activity was found again in the < /b> new leaf (Fig 2) When the < /b> nitrate supply was withdrawn, the < /b> enzyme activity recovered its ... induced high enzyme activity (Fig 2) After 72 h of < /b> induction, the < /b> highest NR activity was found in the < /b> apical fully expanded leaf and corresponded with the < /b> highest nitrate content (Table I) When a new...

Ngày tải lên: 09/08/2014, 04:20

4 203 0
báo cáo khoa học: " Review of "The Globalisation Of Addiction: A Study In Poverty Of The Spirit" by Bruce K. Alexander Harry G Levine" pot

báo cáo khoa học: " Review of "The Globalisation Of Addiction: A Study In Poverty Of The Spirit" by Bruce K. Alexander Harry G Levine" pot

... are not materially poor Neither food, nor shelter, nor the < /b> attainment of < /b> wealth can restore them to well-being Only psychosocial integration itself can that In contrast to material poverty, dislocation ... seems to me that much of < /b> Alexander's argument about the < /b> dislocating effects of < /b> free market capitalism is a thoughtful extension to the < /b> present of < /b> this understanding And in 20 09, deep into the < /b> biggest ... can be borne with dignity by people who face it together as an integrated society On the < /b> other hand, people who have lost their psychosocial integration are demoralized and degraded even if they...

Ngày tải lên: 11/08/2014, 18:20

4 220 0
Báo cáo y học: " Antigenic analysis of classical swine fever virus E2 glycoprotein using pig antibodies identifies residues contributing to antigenic variation of the vaccine C-strain and group 2 strains circulating in China" ppt

Báo cáo y học: " Antigenic analysis of classical swine fever virus E2 glycoprotein using pig antibodies identifies residues contributing to antigenic variation of the vaccine C-strain and group 2 strains circulating in China" ppt

... 5-TAGCTCGAGTCAATCTTCATTTTCCAC BC + AD units BC + AD units C-E2-f 5-TTTGGATCCGCCACCATGGTATTAA GGGGA CAGATCG 5-ATTCTCGAGTCAACCAGCGGCGA GTTGTTCTG 24 42- 2465 C-E2-r 28 04 -28 16 Vaccine C-strain 24 42- 2456 29 55 -29 69 ... affect binding the < /b> most This can be explained by the < /b> fact that the < /b> cysteine residue at this position is critical for the < /b> antigenic structure of < /b> the < /b> protein [22 ] We speculate that E782V substitution ... were above saturation levels to ensure that antibody concentration was not limiting The < /b> binding of < /b> the < /b> wt C-strain rE2 protein to either of < /b> the < /b> sera was set at 100% None of < /b> the < /b> substitutions...

Ngày tải lên: 11/08/2014, 21:21

14 628 0
Transcriptional regulation of the inducible costimulator (ICOS) in t cells

Transcriptional regulation of the inducible costimulator (ICOS) in t cells

... 3q13 .2 16A1 MYPPPY MYPPPY FDPPPF ? ? PI 3K motif, PP2A PI 3K motif, PP2A, ?SHP2 PI 3K motif ITIM motif, SHP2, ITSM motif, SHP1 Two ITIM motifs T T T, NK T, B, M T, B Structure Ligand binding motif Cytoplasmic ... (TCR) and CD28 coengagement We found that the < /b> ectopic expression of < /b> the < /b> transcription factor NFATc2 or a constitutively active form < /b> of < /b> MEK2 that activates ERK amplified icos transcription by ... ERK activity at the < /b> early phase of < /b> naïve Th cell stimulation appears to be critical for deciding in part the < /b> Th differentiation outcome Transient ERK activation due to weak engagement of < /b> TCR by...

Ngày tải lên: 13/09/2015, 19:52

151 311 0
LUYỆN ĐỌC TIẾNG ANH QUA TÁC PHẨM VĂN HỌC-THE ADVENTURE OF THE DYING DETECTIVE ARTHUR CONAN DOYLE (2)

LUYỆN ĐỌC TIẾNG ANH QUA TÁC PHẨM VĂN HỌC-THE ADVENTURE OF THE DYING DETECTIVE ARTHUR CONAN DOYLE (2)

... fear there is no alternative, Watson The < /b> room does not lend itself to concealment, which is as well, as it is the < /b> less likely to arouse suspicion But just there, Watson, I fancy that it could be ... I left him full of < /b> the < /b> image of < /b> this magnificent intellect babbling like a foolish child He had handed me the < /b> key, and with a happy thought I took it with me lest he should lock himself in Mrs ... petulant, penetrating voice "Who is this person? What does he want? Dear me, Staples, how often have I said that I am not to be disturbed in my hours of < /b> study?" There came a gentle flow of < /b> soothing...

Ngày tải lên: 24/10/2013, 20:15

8 636 6
A Brief History of the English Language and Literature, Vol. 2 doc

A Brief History of the English Language and Literature, Vol. 2 doc

... Family+ of < /b> languages That is to say, the < /b> main part or substance of < /b> it can be traced back to the < /b> race which inhabited the < /b> high table-lands that lie to the < /b> back of < /b> the < /b> western end of < /b> the < /b> great range ... found that they had to live together They met at church, in the < /b> market-place, in the < /b> drilling field, at the < /b> archery butts, in the < /b> courtyards of < /b> castles; and, on the < /b> battle-fields of < /b> France, the < /b> Saxon ... Gauls gradually adopted Latin as their mother tongue, and with the < /b> exception of < /b> the < /b> Brộtons of < /b> Brittany left off their Keltic speech almost entirely In adopting the < /b> Latin tongue, they had as in...

Ngày tải lên: 17/03/2014, 02:20

127 960 0
Báo cáo "Eliminating on the divergences of the photon self - energy diagram in (2+1) dimensional quantum electrodynamics " pot

Báo cáo "Eliminating on the divergences of the photon self - energy diagram in (2+1) dimensional quantum electrodynamics " pot

... 1, 2, nf ) For simplicity, but without loss of < /b> generality, we may choose both the < /b> electron mass and two mass of < /b> auxiliary fields to be positive, the < /b> coefficients λi ultimately go to infinity to ... magnetic moment of < /b> the < /b> electron; again, if care is not taken, we may arrive at a wrong physical result In order to get of < /b> this trouble we should pick out the < /b> value of < /b> α that cancels the < /b> contribution ... of < /b> Science, Mathematics - Physics 23 (20 07) 22 -27 23 p k k p -k Figure The < /b> photon self-energy diagram Following the < /b> standard notation, this graph is corresponding to the < /b> formula: Πµν (k) = ie2...

Ngày tải lên: 28/03/2014, 13:20

6 331 0
w