equations of the form y b k t 2 •••••••••••••••

Tài liệu Báo cáo Y học: Puriﬁcation, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

... ratio was obtained The results of 10 20 shots were averaged to obtain the ﬁnal spectrum Enzyme assay The b- amylase activity was determined by different methods The ﬁrst method was based on the ... Inhibition of the enzyme activity by glucose, maltose and cyclohexaamylose For the study of the enzyme inhibition by glucose, maltose and cyclohexaamylose b- amylase activity was measured using the ... the 26 to 28 -kDa polypeptides (together < 35% of the total protein) represent the unglycosylated and glycosylated form of the so-called CalsepRRP [14] N-terminal sequencing of the 55-kDa polypeptide...

Ngày tải lên: 22/02/2014, 07:20

11 613 0

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

... necessary not only to shed some light on the steps involved in the ﬁbrillogenesis, but, most of all, to evaluate the role of Ab-(1– 42) in the interaction with the membrane The structure of Ab-(1– 42) ... not only to overcome the solubility problem, but also to try to simulate in some aspects the physico-chemical Fig Stereo view of the lowest energy structure colored according to the electrostatic ... feature of small and medium size peptides, but in the case of Ab the conformational ﬂexibility is particularly interesting, as it can be related to its biological activity The choice of the solvent...

Ngày tải lên: 08/03/2014, 09:20

7 626 0

Báo cáo Y học: Role of conserved residues within helices IV and VIII of the oxaloacetate decarboxylase b subunit in the energy coupling mechanism of the Na+ pump ppt

... that the Na+ binding of the decarboxylase (Km % mM) was dramatically affected by the S382A mutation We also investigated the stability of OadB with the S382A mutation in the presence of trypsin This ... ligand but is not involved in the proton pathway through the membrane For proton translocation the phenolic hydroxyl of Y2 29 appears to switch between the protonated and the deprotonated state The ... propose that carboxybiotin formed at the carboxyltransferase site of the enzyme switches to the decarboxylase site on OadB where it forms a stable complex, possibly with the side chain of R389, at the...

Ngày tải lên: 08/03/2014, 23:20

8 510 0

Báo cáo Y học: Engineering and mechanistic studies of the Arabidopsis FAE1 b-ketoacyl-CoA synthase, FAE1 KCS pot

... activity Decarboxylation activity of His391A mutant protein was at the background level and H39 1K had decarboxylation activity that was slightly above that of the background (Table 1) Substitution ... acylation of the active site cysteine [24 ] In these studies, substitution of the active-site cysteine to alanine did not signiﬁcantly reduce the decarboxylation activity of the chalcone synthase, thus ... the release of 14CO2 Yeast microsomes exhibited high rates of decarboxylation activity, such that the yeast control activity was equal to the decarboxylation activity of the microsomal FAE1 KCS...

Ngày tải lên: 24/03/2014, 03:21

9 462 0

Báo cáo Y học: Substrate selectivity and sensitivity to inhibition by FK506 and cyclosporin A of calcineurin heterodimers composed of the a or b catalytic subunit potx

... inhibition of CaN phosphatase activity toward the two peptide substrates by the CaN autoinhibitory peptide, and the FKBP 12/ FK506 complex The activation of CaN phosphatase activity towards pNPP by ... CnAa catalytic subunit [16 ,20 ,22 ,23 ] The results presented here are the ﬁrst direct studies of the inhibition of CaN containing the CnAb catalytic subunit by FKBP 12/ FK506 or CyPA/CsA For both immunophilin/immunosuppressant ... affected by CnB, the interaction between CnA and CnB may affect how the FKBP 12/ FK506 and CyPA/CsA complexes affect the substrate-binding cleft Thus, both the catalytic subunit and substrate may...

Ngày tải lên: 24/03/2014, 03:21

9 474 0

Báo cáo y học: "Characterization of the human endogenous retrovirus K Gag protein: identification of protease cleavage sites" ppt

... HERV -K has retained its capability to form viral particles, but there are no signs of infectivity Little is known about the biological function Table Summary of the sequences obtained from Nterminal ... 8 :21 http://www.retrovirology.com/content/8/1 /21 sequence motif The substrate must be in an extended conformation to fit into the active site to be hydrolyzed [20 ] Therefore, we identified the cleavage ... spots isolated by 2- D gel electrophoresis Kraus et al Retrovirology 20 11, 8 :21 http://www.retrovirology.com/content/8/1 /21 Page of Table Summary of the peptide fragments obtained by MS analysis...

Ngày tải lên: 13/08/2014, 01:20

8 209 0

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebraﬁsh, Danio rerio docx

... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...

Ngày tải lên: 16/02/2014, 09:20

20 693 0

Tài liệu Báo cáo khoa học: Speciﬁc membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

... residues of IC initially attract the inhibitor to the membrane surface, and that the membrane–protein interactions are then further stabilized by short-range specific interactions, resulting in the ... subsequently sorted into the lumens to regulate the vacuolar CPY activities through complex formation with the cognate protease The interaction of IC with the yeast Ras GTPase-activating protein, ... affinity and specificity (Table 2) clearly A suggest that the CPY-binding sites [8] and the phospholipid recognition site of IC overlap, and that the N-terminal segment at the CPY-binding sites participates...

Ngày tải lên: 19/02/2014, 05:20

10 647 1

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen afﬁnities of the a and b subunits potx

... crystallographically trapped intermediate in the transition between the T- and R-states Later modeling studies have argued that the R2-state was actually the endpoint of the transition from the T- state The crystallization, ... ; bO2 ÞðaO2 ; bO2 Þ À ða; bO2 ÞðaO2 ; bO2 Þ þ O2 ka À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! hv ð1Þ ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À ðaO2 ; b ðaO2 ; bO2 Þ þ O2 ! kb À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! where (aO2, bO2)(aO2, ... with dimer to the total protein oxygenation must be taken into account and the effect of NaCl concentration on the rates of O2 binding to the a and b subunits within the dimer must be found It...

Ngày tải lên: 16/03/2014, 14:20

11 578 0

Báo cáo khoa học: Characterization of the lipopolysaccharide and b-glucan of the ﬁsh pathogen Francisella victoria ppt

... observation of the weak C-5: H -2 HMBC correlation There was no data for the determination of the conﬁguration of chiral atoms Taken together, these experimental data agreed with the structure (Fig ... been shown to be immuno-stimulatory, whereas at higher concentrations they can be immuno-inhibitory [20 ,21 ] and seem to modulate the release of potent cytokines induced by LPS Possibly the starch-like ... (F) F Victoria regarding the structure of the most obscure region between Fuc R and Fuc L (data not shown) After the determination of the structure of the product 3, the full sequence of the oligosaccharides...

Ngày tải lên: 30/03/2014, 10:20

12 399 0

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

... present study, we noticed that with the exception of the pancreas and the skin, in rat organs, the A and B antigens never codistributed at the cellular level It is unlikely that mAb ED3, the anti -B ... B antigens, the cellular distribution of the two antigens is not always identical (see text for details) The labeling by the anti-A antibody was the same on paraﬃn embedded sections, but no B ... indicated in Table A strong signal was obtained in the oesophagus, the stomach, the colon, the Table Tissue distribution of the Abo mRNA and of the A and B antigens in the BDIX rat Transcripts were...

Ngày tải lên: 31/03/2014, 09:20

8 500 0

cognitive psychology in and out of the lab. 4th ed. - k. galotti (wadsworth, 2008)

... work by touch alone Sometimes pilots retracted their landing gear instead of putting on their brakes; they touched the ground with the belly of the plane at top speed The best way to keep them ... 127 Automaticity and the Effects of Practice 128 The Stroop Task 128 Divided Attention 137 Dual-Task Performance 137 The Attention Hypothesis of Automatization 139 The Psychological Refractory ... seems to be confusing the length of the row with the numerosity of the row In other words, a typical child of this age regards the number of buttons as being the same thing as the length of the...

Ngày tải lên: 12/05/2014, 17:34

705 1,4K 0

Báo cáo toán học: "A Note on the Asymptotic Behavior of the Heights in b-Tries for b Large" ppt

... b) j e 2 k = 2 i log (b! ) 2k b log (2 k ) e z j−1 exp − 2k log − 2 i b z2 k [1 + O (b8 k z 2 )]dz tj−1 e1 /t [1 + O (2 k b 1 t 2 + 2 k t 2 )]dt n! k j − 2k log (b! ) 2k b log (2 k ) (4 b) e e [1 + O(j 2 k ... point at B = −a and a standard application of the steepest descent method yields n! e−a /2 k k ∼ √ e2 b √ 2 kn 2 k/ 2 e 2 a /2 exp − √ 2k 2 a 2 bn b hk n But in this limit we have n! 2k b −kn ... e ∼ bn n b2 k n√ k b n 2 ne2 (A .2) the electronic journal of combinatorics (20 00), #R39 15 √ a n 2k √ba 2 n − √ e b √ √ n n ∼ 2 n exp 2k b − √ a − a2 2b b √ a ∼ 2 b2 k/ 2 exp 2k = Using the above...

Ngày tải lên: 07/08/2014, 06:20

16 353 0

Báo cáo lâm nghiệp: "Influence of the form of nitrogen nutrition reductase activity in young black locus" doc

... with the advent of the N activity, indicates a relationship ase between both enzyme activities The low NR activity (!1 nmol N0 DW!h-!) of -mg2 nodulated plants could be greatly increased by nitrate ... expanded, the NR activity decreased in the previous leaf and the highest enzyme activity was found again in the new leaf (Fig 2) When the nitrate supply was withdrawn, the enzyme activity recovered its ... induced high enzyme activity (Fig 2) After 72 h of induction, the highest NR activity was found in the apical fully expanded leaf and corresponded with the highest nitrate content (Table I) When a new...

Ngày tải lên: 09/08/2014, 04:20

4 203 0

báo cáo khoa học: " Review of "The Globalisation Of Addiction: A Study In Poverty Of The Spirit" by Bruce K. Alexander Harry G Levine" pot

... are not materially poor Neither food, nor shelter, nor the attainment of wealth can restore them to well-being Only psychosocial integration itself can that In contrast to material poverty, dislocation ... seems to me that much of Alexander's argument about the dislocating effects of free market capitalism is a thoughtful extension to the present of this understanding And in 20 09, deep into the biggest ... can be borne with dignity by people who face it together as an integrated society On the other hand, people who have lost their psychosocial integration are demoralized and degraded even if they...

Ngày tải lên: 11/08/2014, 18:20

4 220 0

Báo cáo y học: " Antigenic analysis of classical swine fever virus E2 glycoprotein using pig antibodies identifies residues contributing to antigenic variation of the vaccine C-strain and group 2 strains circulating in China" ppt

... 5-TAGCTCGAGTCAATCTTCATTTTCCAC BC + AD units BC + AD units C-E2-f 5-TTTGGATCCGCCACCATGGTATTAA GGGGA CAGATCG 5-ATTCTCGAGTCAACCAGCGGCGA GTTGTTCTG 24 42- 2465 C-E2-r 28 04 -28 16 Vaccine C-strain 24 42- 2456 29 55 -29 69 ... affect binding the most This can be explained by the fact that the cysteine residue at this position is critical for the antigenic structure of the protein [22 ] We speculate that E782V substitution ... were above saturation levels to ensure that antibody concentration was not limiting The binding of the wt C-strain rE2 protein to either of the sera was set at 100% None of the substitutions...

Ngày tải lên: 11/08/2014, 21:21

14 628 0

Transcriptional regulation of the inducible costimulator (ICOS) in t cells

... 3q13 .2 16A1 MYPPPY MYPPPY FDPPPF ? ? PI 3K motif, PP2A PI 3K motif, PP2A, ?SHP2 PI 3K motif ITIM motif, SHP2, ITSM motif, SHP1 Two ITIM motifs T T T, NK T, B, M T, B Structure Ligand binding motif Cytoplasmic ... (TCR) and CD28 coengagement We found that the ectopic expression of the transcription factor NFATc2 or a constitutively active form of MEK2 that activates ERK amplified icos transcription by ... ERK activity at the early phase of naïve Th cell stimulation appears to be critical for deciding in part the Th differentiation outcome Transient ERK activation due to weak engagement of TCR by...

Ngày tải lên: 13/09/2015, 19:52

151 311 0

LUYỆN ĐỌC TIẾNG ANH QUA TÁC PHẨM VĂN HỌC-THE ADVENTURE OF THE DYING DETECTIVE ARTHUR CONAN DOYLE (2)

... fear there is no alternative, Watson The room does not lend itself to concealment, which is as well, as it is the less likely to arouse suspicion But just there, Watson, I fancy that it could be ... I left him full of the image of this magnificent intellect babbling like a foolish child He had handed me the key, and with a happy thought I took it with me lest he should lock himself in Mrs ... petulant, penetrating voice "Who is this person? What does he want? Dear me, Staples, how often have I said that I am not to be disturbed in my hours of study?" There came a gentle flow of soothing...

Ngày tải lên: 24/10/2013, 20:15

8 636 6

A Brief History of the English Language and Literature, Vol. 2 doc

... Family+ of languages That is to say, the main part or substance of it can be traced back to the race which inhabited the high table-lands that lie to the back of the western end of the great range ... found that they had to live together They met at church, in the market-place, in the drilling field, at the archery butts, in the courtyards of castles; and, on the battle-fields of France, the Saxon ... Gauls gradually adopted Latin as their mother tongue, and with the exception of the Brộtons of Brittany left off their Keltic speech almost entirely In adopting the Latin tongue, they had as in...

Ngày tải lên: 17/03/2014, 02:20

127 960 0

Báo cáo "Eliminating on the divergences of the photon self - energy diagram in (2+1) dimensional quantum electrodynamics " pot

... 1, 2, nf ) For simplicity, but without loss of generality, we may choose both the electron mass and two mass of auxiliary fields to be positive, the coefficients λi ultimately go to infinity to ... magnetic moment of the electron; again, if care is not taken, we may arrive at a wrong physical result In order to get of this trouble we should pick out the value of α that cancels the contribution ... of Science, Mathematics - Physics 23 (20 07) 22 -27 23 p k k p -k Figure The photon self-energy diagram Following the standard notation, this graph is corresponding to the formula: Πµν (k) = ie2...

Ngày tải lên: 28/03/2014, 13:20

6 331 0