epitope s and non related epitope s on capza 1

Báo cáo y học: " Induction of multiple matrix metalloproteinases in human dermal and synovial fibroblasts by Staphylococcus aureus: implications in the pathogenesis of septic arthritis and other soft tissue infections" pdf

Báo cáo y học: " Induction of multiple matrix metalloproteinases in human dermal and synovial fibroblasts by Staphylococcus aureus: implications in the pathogenesis of septic arthritis and other soft tissue infections" pdf

... cells such as fibroblasts, fibroblast -related cells, chondrocytes, neutrophils, and monocytes/macrophages in response to both infectious assaults and inflammatory cytokines such as TNF-α and IL -1 ... expression remains to be seen In addition to the bone and joint infections, S aureus is also the prime causative agent in many skin and soft tissue infections (SSTIs), which can be manifested as superficial ... (TNF)α, and interferons (IFN-α and IFN-γ) are released from host cells in response to S aureus infection and these are potent inducers of MMPs [11 -15 ] Staphylococcal capsule polysaccharides, toxins,...

Ngày tải lên: 09/08/2014, 08:23

14 428 0
Báo cáo y học: "Transcriptional regulation of matrix metalloproteinase-1 and collagen 1A2 explains the anti-fibrotic effect exerted by proteasome inhibition in human dermal fibroblasts" docx

Báo cáo y học: "Transcriptional regulation of matrix metalloproteinase-1 and collagen 1A2 explains the anti-fibrotic effect exerted by proteasome inhibition in human dermal fibroblasts" docx

... transfection and reporter gene assays COL1A1 Hs0 016 4099_m1 TIMP -1 Hs0 017 1558_m1 MMP -1 Hs00233958_m1 MMP-2 Hs00234422_m1 HsEEF1A1 CACCTGAGCAGTGAAGCCAGCTGCTT DNA pull-down assay Biotin-MMP -1 -S GATCGAGAGGATGTTATAAAGCATG ... induction of MMP -1 expression via proximal AP -1 sites and the repression of COL1A2 transcription via SP1 sites Materials and methods Cell culture A primary human fibroblast cell line was established ... magnification of × 40 Statistical analysis The Student t test was used for statistical analysis A P value of less than 0.05 was considered significant To assess the normal distribution of our...

Ngày tải lên: 12/08/2014, 12:20

14 287 0
Báo cáo y học: " Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pdf

Báo cáo y học: " Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pdf

... Thurings Stiftelse (LA, ASJ), S derström-Königska and Wolffs stiftelser (GSL), and Swedish Medical Society (GSL) Author details Department of Neuroscience, Karolinska Institutet, Retzius väg 8, 17 1 ... which resulted in a linear standard plot Statistics Comparisons across treatments were done by repeated measures ANOVA with Bonferroni s Multiple Comparison Test using GraphPad (GraphPad Software, ... Brain Res 2006, 10 7 310 74:25-37 13 Olsson SK, Samuelsson M, Saetre P, Lindstrom L, Jonsson EG, Nordin C, Engberg G, Erhardt S, Landen M: Elevated levels of kynurenic acid in the cerebrospinal fluid...

Ngày tải lên: 11/08/2014, 03:20

7 459 0
Báo cáo y học: "Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pot

Báo cáo y học: "Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pot

... Thurings Stiftelse (LA, ASJ), S derström-Königska and Wolffs stiftelser (GSL), and Swedish Medical Society (GSL) Author details Department of Neuroscience, Karolinska Institutet, Retzius väg 8, 17 1 ... which resulted in a linear standard plot Statistics Comparisons across treatments were done by repeated measures ANOVA with Bonferroni s Multiple Comparison Test using GraphPad (GraphPad Software, ... Brain Res 2006, 10 7 310 74:25-37 13 Olsson SK, Samuelsson M, Saetre P, Lindstrom L, Jonsson EG, Nordin C, Engberg G, Erhardt S, Landen M: Elevated levels of kynurenic acid in the cerebrospinal fluid...

Ngày tải lên: 11/08/2014, 06:23

7 360 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in human malignancies and potential therapy pdf

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in human malignancies and potential therapy pdf

... on the presence of Meis1 and Pbx proteins, as well as on the presence of Men1 and Ledgf [19 – 21] More recently, it has been demonstrated that overexpressed Meis1 results in the establishment of ... issues arising from supporting information (other than missing files) should be addressed to the authors FEBS Journal 277 (2 010 ) 18 22 18 31 ª 2 010 The Author Journal compilation ª 2 010 FEBS 18 31 ... hydrolysed by the endopeptidase Taspase1 [11 ] This allows it to assembly into a high-molecular mass complex which confers the methylation of histone core particles at histone H3 lysine (H3K4) residues...

Ngày tải lên: 16/02/2014, 14:20

10 667 0
Báo cáo khoa học: Alternative splicing: role of pseudoexons in human disease and potential therapeutic strategies pot

Báo cáo khoa học: Alternative splicing: role of pseudoexons in human disease and potential therapeutic strategies pot

... inversion 28 kb gene inversion 5¢ss creation 5¢ss creation 5¢ss creation 5¢ss creation 3¢ss creation 5¢ss creation 3¢ss creation 5¢ss creation 3¢ss creation 5¢ss creation SRE creation 5¢ss creation ... 5¢ss creation 5¢ss creation SRE creation Downstream 3¢ss deletion 5¢ss creation 3¢ss creation 3¢ss creation 3¢ss creation SRE creation 5¢ss creation 5¢ss creation 5¢ss creation 5¢ss creation ... mutation Reference DBASS3 ⁄ DBASS5 reference SRE creation SRE deletion 5¢ss creation 5¢ss creation 5¢ss creation 5¢ss creation 3¢ss creation Downstream 3¢ss deletion 5¢ss creation 5¢ss creation 5¢ss...

Ngày tải lên: 06/03/2014, 09:22

15 472 0
Báo cáo khoa học: Expression of cholinesterases in human kidney and its variation in renal cell carcinoma types pdf

Báo cáo khoa học: Expression of cholinesterases in human kidney and its variation in renal cell carcinoma types pdf

... butyrylcholinesterase itself in megakaryocytopoiesis suppression and retinal cell differentiation [16 ] The expression of acetylcholinesterase and butyrylcholinesterase in neural and non- neural tumours [26] ... epithelia supports their programmed synthesis The overexpression of cholinesterases in pRCC contrasts with their underexpression in cancerous lymph nodes and gut, and these features highlight ... (A) Scheme showing the position of the primers (B) Primer sequences and PCR product sizes Gene ID and accession numbers are as follows: ACHE, 43 and ENSG 00000087085; BCHE, 590 and ENSG 0000 011 420;...

Ngày tải lên: 06/03/2014, 22:21

11 476 0
Báo cáo y học: "All-trans retinoic acid suppresses interleukin-6 expression in interleukin-1-stimulated synovial fibroblasts by inhibition of ERK1/2 pathway independently of RAR activation" ppsx

Báo cáo y học: "All-trans retinoic acid suppresses interleukin-6 expression in interleukin-1-stimulated synovial fibroblasts by inhibition of ERK1/2 pathway independently of RAR activation" ppsx

... http://arthritis-research.com/content /10 /6/R1 41 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Tan PL, Farmiloe S, Yeoman S, Watson JD: Expression of the interleukin gene in rheumatoid synovial ... expression and statistical analysis SS performed the TransAm™ assays and contributed to the experiments with PD-98059 PN supervised the study design and the drafting of the manuscript J-YJ contributed ... detected in basal conditions but were strongly expressed in response to IL -1 In IL -1- stimulated synovial fibroblasts, ATRA (RAR agonist) decreased IL-6 gene expression from 70% (Figure 2a) and IL6...

Ngày tải lên: 09/08/2014, 01:22

12 388 0
Báo cáo y học: "Post-translational aging of proteins in osteoarthritic cartilage and synovial fluid as measured by isomerized aspartate" pot

Báo cáo y học: "Post-translational aging of proteins in osteoarthritic cartilage and synovial fluid as measured by isomerized aspartate" pot

... Jerome CP: Osteoarthritis in cynomolgus macaques III: effects of age, gender, and subchondral bone thickness on the severity of disease J Bone Miner Res 19 96, 11 :12 09 -12 17 Stabler TV, Byers SS, Zura ... the study, supervised the project, and assisted in both the statistical analysis and the manuscript preparation and editing All authors read and approved the final manuscript 10 11 12 13 14 15 16 ... Female 11 L/NL No L, lesion; NL, non- lesioned osteoarthritis cartilage; NLD, deep non- lesioned osteoarthritis cartilage; NLS, superficial non- lesioned osteoarthritis cartilage; OA, osteoarthritis...

Ngày tải lên: 09/08/2014, 14:20

9 265 0
ADAM10 is expressed in human podocytes and found in urinary vesicles of patients with glomerular kidney diseases pptx

ADAM10 is expressed in human podocytes and found in urinary vesicles of patients with glomerular kidney diseases pptx

... incubation with blocking buffer (0 .1% Triton X -10 0/PBS containing 1% BSA and 10 % horse serum) for h, tissue sections were incubated with the first antibodies (diluted in 1% BSA /10 % horse serum/PBS/0 .1% ... kidney diseases were used to isolate urinary vesicles with serial centrifugation steps as described previously [19 ] Results Surface expression of ADAM10 and L1 is reduced during differentiation of ... Interestingly, undifferentiated podocytes showed strong ADAM10 and L1 surface expression (Fig 1A and 1B, green line) In contrast, in differentiated podocytes the surface expression of ADAM10 and L1...

Ngày tải lên: 10/08/2014, 05:21

9 218 0
Damaged DNA-binding protein 2 (DDB2) protects against UV irradiation in human cells and Drosophila ppt

Damaged DNA-binding protein 2 (DDB2) protects against UV irradiation in human cells and Drosophila ppt

... analyzed using a Becton Dickinson FACScan (San Jose, CA) with 10 ,000 events per determination LYSYS II software was used to assess cell cycle distribution Construction and production of recombinant ... Acad Sci USA 19 98, 95:2509-2 514 Sun CL, Chao CC: Cross-resistance to death ligand-induced apoptosis in cisplatin-selected HeLa cells associated with overexpression of DDB2 and subsequent induction ... in causing apoptosis [34] Additional overexpression of E2F1 does not increase endogenous cFLIP expression more than overexpression of DDB2 alone (data not shown) Thus, the increased E2F1 level...

Ngày tải lên: 10/08/2014, 05:21

14 143 0
Báo cáo khoa hoc:" Lack of association between sCTLA-4 levels in human plasma and common CTLA-4 polymorphisms" ppsx

Báo cáo khoa hoc:" Lack of association between sCTLA-4 levels in human plasma and common CTLA-4 polymorphisms" ppsx

... mediated diseases including autoimmune thyroid disease [6 ,19 ], systemic lupus erythematosus [20] cutaneous systemic sclerosis [ 21] , allergic asthma [22,23], psoriasis vulgaris [24], and autoimmune ... Results in BioMedicine 2008, 7:8 ciations between SNPs within and around the CLTA-4 region and rheumatoid arthritis [10 ,11 ], celiac disease [12 -14 ], type I diabetes, [15 ], myasthenia gravis [16 ,17 ] ... commonly tested SNPS and circulating levels of sCTLA-4 in the presence or absence of autoimmune disease Methods Study Population The sample set consisted of 81 serum samples from patients with a variety...

Ngày tải lên: 11/08/2014, 07:20

4 298 0
Báo cáo y học: " Histone deacetylase inhibitors induce apoptosis in human eosinophils and neutrophils" docx

Báo cáo y học: " Histone deacetylase inhibitors induce apoptosis in human eosinophils and neutrophils" docx

... results Expression of HDAC5, and 11 was very low in eosinophils and expression of HDAC5, and 11 was very low in neutrophils (Figure 7) The expression of HDAC2 and HDAC9 was higher in neutrophils ... spontaneous apoptosis as previously described [16 ] These results suggest a role for JNK and caspases and 6, but not 8, in the mechanism of action of TSA in human eosinophils This interpretation may ... of caspases in apoptosis in general is well established, surprisingly little is known of the role caspases in human eosinophils [3,30] and the actual caspases mediating apoptosis in human eosinophils...

Ngày tải lên: 11/08/2014, 08:22

15 332 0
Báo cáo y học: " Differential cell reaction upon Toll-like receptor 4 and 9 activation in human alveolar and lung interstitial macrophages" pot

Báo cáo y học: " Differential cell reaction upon Toll-like receptor 4 and 9 activation in human alveolar and lung interstitial macrophages" pot

... Barnes PJ, Adcock IM: Cigarette smoking reduces histone deacetylase expression, enhances cytokine expression, and inhibits glucocorticoid actions in alveolar macrophages FASEB J 20 01, 15 :11 10 -11 12 ... Hoppstädter et al Respiratory Research 2 010 , 11 :12 4 http://respiratory-research.com/content /11 /1/ 124 obstructive pulmonary disease (COPD) [2] and to regulate immune responses in allergic disease ... days to restore receptors as shown previously for tissue macrophages isolated by enzyme perfusion [14 ] Medium was changed every other day Isolation of monocytes and cultivation of DCs Monocytes...

Ngày tải lên: 12/08/2014, 11:22

15 375 0
Báo cáo y học: "Relative percentage and zonal distribution of mesenchymal progenitor cells in human osteoarthritic and normal cartilage" potx

Báo cáo y học: "Relative percentage and zonal distribution of mesenchymal progenitor cells in human osteoarthritic and normal cartilage" potx

... Arab Emirates Page 14 of 15 10 11 12 13 14 15 Authors’ contributions DP and SA contributed to study conception and design, acquisition of data, analysis and interpretation of data, and drafting ... Therapy 2 011 , 13 :R64 http://arthritis-research.com/content /13 /2/R64 Page of 15 Figure FACS analysis of CD105 and CD166 expressions on isolated normal and osteoarthritis (OA) chondrocytes and enrichment ... one-tailed Spearman rank test (since a negative correlation between the parameters was not expected) and SPSS 12 .0 software (SPSS, Inc., Chicago, IL, USA) Results Expressions of CD105 and CD166...

Ngày tải lên: 12/08/2014, 15:23

15 371 0
Báo cáo y học: "Expression of leukemia inhibitory factor (LIF) and its receptor gp190 in human liver and in cultured human liver myofibroblasts. Cloning of new isoforms of LIF mRNA" pdf

Báo cáo y học: "Expression of leukemia inhibitory factor (LIF) and its receptor gp190 in human liver and in cultured human liver myofibroblasts. Cloning of new isoforms of LIF mRNA" pdf

... sinusoids In fibrotic liver tissues, an intense expression of LIF was seen along fibrous septa which is consistent with the presence of myofibroblasts (Fig 1B) Staining adjacent sections with ... factor and its 1Oacyl analogue by liver fat-storing cells Gastroenterology 19 94, 10 6 :13 01 13 11 Marra F: Hepatic stellate cells and the regulation of liver inflammation J Hepatol 19 99, 31: 112 0 11 30 ... mice [7]; this location likely qualifies those cells as myofibroblasts LIF expression by liver myofibroblasts is also reminiscent of its expression by kidney mesangial cells, a close relative...

Ngày tải lên: 13/08/2014, 13:20

10 292 0
Báo cáo y học: "Genome-wide promoter extraction and analysis in human, mouse, and ra" potx

Báo cáo y học: "Genome-wide promoter extraction and analysis in human, mouse, and ra" potx

... binding sites (TFBSs) and regulation pathways/networks as well as cis-element analysis tools Figure shows some representative screen shots of the database user interface For the user 's convenience, ... island relationship We used the new CpG-island definition [24] to search genomes of the three species to collect CpG islands A gene is considered as CpG-island -related only if there is at least ... Method_ 3s (b) Non- CpG Sn Non- CpG Sp CpG Sn CpG Sp Facilitating large-scale gene regulation studies and promoter array construction Method_ 1s Method_ 2s Method_ 3s interactions information Genome...

Ngày tải lên: 14/08/2014, 14:22

12 254 0
Báo cáo sinh học: "Electroporation by nucleofector is the best nonviral transfection technique in human endothelial and smooth muscle cells" pdf

Báo cáo sinh học: "Electroporation by nucleofector is the best nonviral transfection technique in human endothelial and smooth muscle cells" pdf

... available for AoSMC and CoAEC These methods were tested and the results were compared with the electroporation results For AoSMC we tested two cell suspensions, × 10 5 and × 10 6cells per reaction Both ... genes to cells in relevant disease states One example is the cardiovascular field [25-27], and this is the reason why we tested and optimized these techniques using aortic and coronary artery SMC ... transfection methods electroporation, nucleofection and PCI, and supervised the following optimalization of these methods She was responsible for writing the manuscript B.B and K.T were responsible...

Ngày tải lên: 14/08/2014, 19:22

13 390 0
w