... Gopalsamy, Stability and Oscillations in Delay Differential Equations of Population Dynamics, vol 74 of Mathematics and Its Applications, Kluwer Academic Publishers, Dordrecht, The Netherlands, ... LotkaVolterra competitive system with delays and feedback controls,” Journal of Computational and Applied Mathematics, vol 211, no 1, pp 1–10, 2008 S Ahmad, “On the nonautonomous Volterra-Lotka ... competition equations,” Proceedings of the American Mathematical Society, vol 117, no 1, pp 199–204, 1993 S Ahmad and A C Lazer, “On the nonautonomous N-competing species problems,” Applicable Analysis,...
Ngày tải lên: 21/06/2014, 11:20
... Mental health, social functioning, and disability in postwar Afghanistan JAMA 2004, 292(5):575-584 Lopes Cardozo B, Vergara A, Agani F, Gotway CA: Mental health, social functioning, and attitudes ... indicate better health Scores above and below 50 are considered above and below the average in the general U.S population [8] The SF-8 was translated into Luo, the main language of Gulu and Amuru ... comprehensively address physical and mental health [4] The ability to measure general physical and mental health amongst a conflict-affected population is important to help understand the overall health...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: "Approaching the MIMO Capacity with a Low-Rate Feedback Channel in V-BLAST" docx
... and SRPQ2 The MIMO capacity is the closed-loop MIMO capacity as in Section For each average SNR ρ, H is generated 1000 times and the average capacity is calculated assuming that a scalar capacity-achieving ... low-rate feedback channel, [13] introduced rate adaptation at each antenna in V-BLAST to overcome this problem We extend their approach to both rate and power adaptations at each antenna and theoretically ... MIMO capacity Optimal power allocation with PARC Equal power allocation with PARC Suboptimal power allocation with PARC Equal power & rate allocation (MMSE V-BLAST) MIMO capacity Optimal power allocation...
Ngày tải lên: 23/06/2014, 01:20
Báo cáo toán học: "On the Generalized Convolution with a Weight - Function for Fourier, Fourier Cosine and Sine Transforms" pot
... Their Application, Russian Academy, Moscow, 1997 16 Nguyen Xuan Thao and Trinh Tuan, On the generalized convolution for I transform, Acta Math Vietnam 28 (2003) 159–174 17 M Saigo and S B Yakubovich, ... convolution with a weightfunction for the Cosine - Fourier integral transform, Acta Math Vietnam 29 (2004) 149–162 15 Nguyen Xuan Thao and Nguyen Thanh Hai, Convolution for Integral Transforms and Their ... Russian) V A Kakichev and Nguyen Xuan Thao, On the design method for the generalized integral convolution, Izv Vuzov Mat (1998) 31–40 (in Russian) V A Kakichev and Nguyen Xuan Thao, On the generalized...
Ngày tải lên: 06/08/2014, 05:20
Báo cáo y học: "Long term follow up after surgery in congenitally corrected transposition of the great arteries with a right ventricle in the systemic circulation" pot
... cardiac transplantation at ages 33, 34 and 47 respectively These three patients had an intact atrial and ventricular septum and an adequate subpulmonary outflow One patient had a dextrocardia ... dextrocardia and a long history of cardiac failure before transplantation The second patient also had a dextrocardia, with additionally mitral and aorta regurgitation, resulting in cardiac failure, finally ... Sharma R, Talwar S, Marwah A, Shah S, Maheshwari S, Suresh P, Garg R, Singh bali B, Juneja R, Saxena A, Sunder Kothari S: Anatomic repair for congenitally corrected transposition of the great arteries...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: " Carcinoid tumor of the verumontanum (colliculus seminalis) of the prostatic urethra with a coexisting prostatic adenocarcinoma: a case report" docx
... Katayama M, Hara A, Hirose Y, Yamada Y, Kuno T, Sakata K, Morioka T, Inamine M, Shibuya C, Mori H, Yoshimi N: Carcinoid tumor in the female urethral orifice: rare case report and a review of the ... were without evidence of malignancy Approximately 17 mm from the invasive adenocarcinoma, within the verumontanum of the prostatic urethra of our patient, there was a mm maximal dimension tumor with ... revealed cells forming nested, acinar and trabecular architecture with small uniform nuclei, a granular “salt and pepper” chromatin pattern, and moderate amounts of granular cytoplasm (Figure 2A) ...
Ngày tải lên: 11/08/2014, 14:21
Báo cáo y học: "The Nordic back pain subpopulation program: Can low back pain patterns be predicted from the first consultation with a chiropractor" ppt
... First, each of the independent variables was tested against each of the outcome variables by Fisher’s exact test or regression analysis with one explanatory variable Thereafter, the variables that ... that were associated with one of the outcome variables were considered for a multivariable analysis, providing that these associations had a p-value of less than 0.1 The multivariable analyses were ... patients included for the study Page of 0.05 The statistical package STATA 10.1 (StataCorp, Texas, USA) was used for the analyses Results Descriptive data Seven chiropractors (all women, average...
Ngày tải lên: 13/08/2014, 14:20
de matos and fernandes-testing the markov property with ultra-high frequency financial data
... TESTING THE MARKOV PROPERTY WITH ULTRA HIGH FREQUENCY FINANCIAL DATA Abstract: This paper develops a framework to test whether discrete-valued irregularly-spaced financial transactions data follow a ... on the fact that, in contrast to smoothing-based tests, empirical measure-based tests usually have power against all alternatives at distance n−1/2 Linton and Gozalo (1999) show that the asymptotic ... a nonparametric testing procedure, the first uses the fact that the Chapman-Kolmogorov equation must hold in order for a Markov process compatible with the data to exist If, on the one hand, the...
Ngày tải lên: 31/10/2014, 11:49
Designing a supplementary reading syllabus with a view to improving reading skills for the first-year English majors at Hai Phong Private University
... of the syllabus, the advantages and disadvantages of each syllabus type, the background of the target learners as well as the teaching situation at HPU and the survey results, the author has ... surface performance data and look at the competence that underlies the performance Nonetheless, this approach still regards the learner as a language user rather than a language learner and it is ... inevitable part in the process of language learning and teaching Beside its advantages above, a syllabus also exposes some dangers: A syllabus can never be more than a statement of a teaching ideal...
Ngày tải lên: 19/03/2015, 10:28
Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3
... is aimed at collecting both quantitative and qualitative data to make use of analytical and exploratory- interpretive paradigms in applied linguistics The quantitative and qualitative data collected ... content themselves with the thought that Tourism students will be exposed to cultural material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack ... of adequate training HCC teachers may not have been adequately trained in the teaching of culture and, therefore, they not have strategies and clear goals that help them to create a viable framework...
Ngày tải lên: 07/11/2012, 15:06
Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx
... British page 49 East Pakistan This demand was the immediate cause The fifth and final cause of the war was the impact of a major hurricane that affected East Pakistan The apathy of the West Pakistani ... China Sea Manama Malaysia Indonesia Brunei 2,227 sq.mi Malaysia Gulf of Bahrain Qatar page 45 Bandar Seri Begawan Saudi Arabia Bahrain 257 sq.mi Belgium Germany Luxembourg Singapore France Singapore ... Luanda Muskat Oman Angola Russian Federation Argentina Chile Atlantic Ocean Gulf of Riga Latvia Riga Lithuania Kaliningrad Oblast Belarus Poland South China Sea Rio Grande Indonesia Oecussi (Ambeno)...
Ngày tải lên: 16/02/2014, 11:20
Tài liệu THE WEALTH REPORT 2012: A GLOBAL PERSPECTIVE ON PRIME PROPERTY AND WEALTH pptx
... German Chinese Singaporean Canadian Nationalities growing in importance Chinese Indian Brazilian Malaysian Norwegian Kazakhstani UAE Australian Indonesian Turkish Nationalities to watch Egyptian ... 29 PIRI AVERAGE PRICE CHANGE Rank Location Country/Area Nairobi Kenya Kenyan Coast Kenya Miami US Bali Indonesia Jakarta Indonesia London UK Vancouver Canada Moscow Russia Toronto Canada 10 Beijing ... Zealand 44 Washington DC US 45 Barcelona Spain 46 Paris France 47 Dubai UAE 48 Shanghai China 49 Madrid Spain 50 Singapore Singapore 51 Geneva Switzerland 52 Tuscany Italy 53 Barbados Caribbean...
Ngày tải lên: 16/02/2014, 11:20
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... Medical Research Council of Australia, the Australian Research Council, the National Heart Foundation of Australia (to RNP and AMB), Research Grants HL-06350 and HL-32656 from the National Institutes ... affinity heparin Heparin pentasaccharide – Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate Heparin Heparin Heparin – Heparin Heparin ⁄ calcium 4 2 4 1 3 Factor Xa HCII ... and the rates of interaction in the presence and absence of heparin pentasaccharide (Table 1), one can calculate that the half-life of enzyme activity in the absence of heparin pentasaccharide would...
Ngày tải lên: 20/02/2014, 02:21
The World with a Thousand Moons pdf
... elements He made up this formula, and tried it on a gravitation-paralysis case a space-man who's lain paralyzed for years The formula was designed to strengthen the human nervous system against the shock ... escort of armed pirates guarding them, and Dark and Holk Or ahead, they started through the jungle toward the pirate camp 38 Chapter Asteroid Horror T he pirate encampment was a big clearing hacked ... standing tense, had had an idea A desperate chance to make a break, in the face of Murdock's atom-gun The captain had said that he had just ordered the pilot to slow down the Sunsprite In a moment...
Ngày tải lên: 06/03/2014, 00:20
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG ... et al sequence verified and named pAff8eGFPLacUV5 and pAff8eGFPTrc, respectively The gene for the T7 promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and ... this leakage, the analyzed differences in mRNA levels most probably are a slight misrepresentation of the total mRNA levels within the cell at harvest One reason for the spread in the amount...
Ngày tải lên: 06/03/2014, 01:20
Đề tài " The distribution of integers with a divisor in a given interval " ppt
... (7.2) write a = a1 a2 with pβ , a1 = pβ a, β≥2 so that (a1 , a2 ) = and a2 is square-free By Lemma 3.1, L (a; σ) ≤ τ (a1 )L (a2 ; σ) ≤ στ (a1 )τ (a2 ) (7.6) Also (7.7) a1 τ (a1 ) a1 >w −3/4 a1 w−1/4 ... constant support and many helpful conversations about the paper Much of this paper was written while the author enjoyed the hospitality of the Institute of Mathematics and Informatics, Bulgarian Academy ... to lie all above their expected values An analogy from probability theory is to ask for the likelihood that a random walk on the real numbers, with each step haveing zero expectation, stays completely...
Ngày tải lên: 06/03/2014, 08:21
Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx
... aaagtgaagtcc-3¢ and 5¢-attattggatccctattgctggtccgattctgccag-3¢ 3-TPR NlpI primers (residues 62–197) were 5¢-aataatccatgg gggcacagcttttatatgagcgcggag-3¢ and 5¢-aataatggatcctcactgttc cttatccgatttttcgaagtgc-3¢ ... chemically synthesized by the W M Keck Core Facility (Yale University, New Haven, CT, USA) Primers to amplify mature NlpI (residues 20–294) were 5¢-aataatccatggggagtaatacttcctggcgta aaagtgaagtcc-3¢ ... beam time Anomalous data was nevertheless complete for the remote wavelength ˚ ˚ (Table 1) Data from 30 A to 2.0 A were indexed and scaled with the hkl2000 software package [37] (Table 1) The...
Ngày tải lên: 07/03/2014, 16:20