C Programming Tutorial doc
... blocks of the C programming language, let us look a bare minimum C program structure so that we can take it as a reference in upcoming chapters. C Hello World Example A C program basically consists ... fraction */ Character constants Character literals are enclosed in single quotes e.g., 'x' and can be stored in a simple variable of char type. A character literal can be a plain character ... produces efficient programs. It can handle low-level activities. It can be compiled on a variety of computer platforms. Facts about C C was invented to write an operating system called...
Ngày tải lên: 11/03/2014, 08:20
... to form abstract colored candles. COFFEE BEANS Add coffee beans to the base of your molds and coffee essence to the wax for the fragrance. Gently pour in the wax. COLORED BEANS Add colored ... Candle 7. Candle Making Projects - Votive Candles 8. Candle Making Projects - Marble Candles 9. Candle Making Projects - Ice Candles 10. Candle Making Projects - Innovative Candle Ideas ENJOY AND ... DISCOVER. 1. CONTENTS Introduction Equipment You Need for Candle Making Tips to be Aware of for Better Candle Making Candle Making Safety Making Your Own Candles - Two Colored Pillar Candle ...
Ngày tải lên: 11/03/2014, 13:20
Tài liệu C Programming for Embedded Systems docx
... to C necessary for targeting an embedded environment, and the common components of a successful development project. C is the language of choice for programming larger microcontrollers (MCU), ... instructions to the COPCR register. Interestingly, the COP watchdog is dependent upon the system clock; a clock monitor circuit resets the MCU if the clock stops, and thereby renders the COP watchdog ... manoeuvre. Programming the prescalar and starting the clock are tasks of the software developer. Knowing the processor clock frequency, and choosing correct prescalar values, you can achieve accurate...
Ngày tải lên: 22/12/2013, 02:17
Symbian OS Explained Effective C++ Programming for Smartphones phần 7 pdf
Ngày tải lên: 13/08/2014, 08:21
Tài liệu Matlab tutorial for systems and control theory pdf
... directory, checking the path to the working directory, and changing the working directory. MATLAB checks for MATLAB files in certain directories which are controlled by the command ‘path’. The command ... MathWorks, Inc.) whose URL is http://www.mathworks.com. Full documentation can be purchased by contacting The MathWorks. 2 Getting Started On Project Athena, MATLAB can be accessed directly from ... 5.1 Arithmetic matrix operations The basic arithmetic operations on matrices (and of course scalars which are special cases of matrices) are: + addition - subtraction * multiplication / right...
Ngày tải lên: 12/12/2013, 07:15
Tài liệu Real-Time Digital Signal Processing - Appendix C: Introduction of C Programming for DSP Applications ppt
... %f indicates the number is floating-point data. In addition, the formatted I/O functions also recognize %d for decimal integers, %x for hexadecimals, %c for characters, and %s for character strings. The ... PROGRAMMING FOR DSP APPLICATIONS Appendix C Introduction of C Programming for DSP Applications C has become the language of choice for many DSP software developments not only because of its powerful commands ... example. C compiler translates high-level C programs into machine language that can be executed by computers or DSP proces- sors such as the TMS32 0C5 5x. The fact that C compilers are available for...
Ngày tải lên: 25/01/2014, 19:20
Tài liệu Practical C Programming Third Edition pdf
... low-cost MS-DOS C+ + compiler called Turbo C+ +. This compiler will compile both C and C+ + code. We will describe only how to compile C code. Turbo C+ + is ideal for learning. The command line for ... generic cc compiler or the Free Software Foundation’s gcc compiler. For MS-DOS/Windows users, instructions are included for Borland C+ +, Turbo C+ +, and Microsoft Visual C+ +. (These compilers compile ... The commands for the most popular compilers are listed below. UNIX cc compiler (generic UNIX) Most UNIX-based compilers follow the same generic standard. The C compiler is named cc, and to compile...
Ngày tải lên: 14/02/2014, 20:20
PERIPHERAL BLOOD BASED C-PCR ASSAY FOR DIAGNOSING EXTRA-PULMONARY TUBERCULOSIS pdf
... was: Forward primer (FW) 5- TCCGCTGCCAGTCGTCTTCC-3 and Reverse primer (RW) 5- GTCCTCGCGAGTCTAGGCCA – 3. Amplification reaction was performed in 25 l of master cocktail containing ... quantification of mycobacterial Fig. 6—Representative agarose gel electrophoresis picture(s) of C- PCR amplified products for the calculation of mycobacterial load from peripheral blood specimens ... used specimen for revealing the presence of tubercle bacilli in TB. However, its clinical significance in EPTB is very discouraging 3 . The diagnosis in such cases posses great challenge...
Ngày tải lên: 06/03/2014, 04:20