electromyography as a tool to estimate muscle forces

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...

Ngày tải lên: 19/02/2014, 17:20

12 620 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

... those  measures  that  are  being  used  in the target areas as well as foreign countries,  such  as Indonesia,  China,  Bangladesh,  Germany,  Mexico,  Colombia,  USA.  Some  of  them are introduced as follows.  ... Table 7. Standardized score for costs of combinations  Measure  A1 +A2 .3  A1 +B1  A1 +B2  A1 +B1+B2  A2 .1 +A2 .3  A2 .1+B1  A2 .2 +A2 .3  A2 .2+B1  A2 .3+B1  A2 .3+B1+B2  Standardized cost  Standardized score ... and  accounts  for  75%  to 85%  of  the  total  yearly  rainfall,  whereas  the  dry  season  lasts  up  to 6  months,  from  February  to July  and occupies only 15‐25% of the total rainfall.  ...

Ngày tải lên: 22/03/2014, 12:20

13 489 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt

Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt

... diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching medical students and ... Journal of Obstetrics and Gynaecology, which has substantiated information about ovarian cancers and amenorrhea [8] In this way, continually organizing and updating information on an Ishikawa diagram ... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea...

Ngày tải lên: 11/08/2014, 00:23

3 381 0
Báo cáo khoa học: "Hyperglycaemic index as a tool to assess glucose control: a retrospective study" docx

Báo cáo khoa học: "Hyperglycaemic index as a tool to assess glucose control: a retrospective study" docx

... that possess a patient database management system that can provide automated input for the HGI calculation The fact that HGI expresses glucose regulation as a single value has methodological advantages ... mean age was 55 years (standard deviation 19 years) and 65% were male Table lists the demographical data and glucose-related measures for survivors and nonsurvivors APACHE II scores were available ... were obtained from the central laboratory database Therapeutic protocol Patients were fed enterally as soon as possible Total parenteral nutrition was only given when enteral nutrition failed Concentrated...

Ngày tải lên: 12/08/2014, 20:20

6 264 0
Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx

Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx

... Figure A: original data B: normalised data C: standardised data D: data after factor correction Note that normalisation, standardisation, and factor correction reduce the variation within each condition ... approach assigns part of the variation to the estimated session factors The ratio approach can be seen as a special case, in which the user assumes that the multiplicative factor is the same for ... was measured in different sessions In simulating data, the overall mean was set to 100 and the standard deviation was set to 10 Factors and condition effects are given in the table The estimated...

Ngày tải lên: 13/08/2014, 09:21

8 306 0
báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot

báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot

... FA, Ventura JL, Casas M, Casas H, Pages T, Rama R, Ricart A, Palacios L, Viscor G: Erythropoietin acute reaction and haematological adaptations to short, intermittent hypobaric hypoxia Eur J Appl ... installation of the hypobaric chamber and annexed facilities We are also grateful to Mr Juan A Silva from Universidad de Antofagasta (Chile) by his collaboration in some data collection, and to ... and/or assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript writing All authors read and approved the final manuscript Additional...

Ngày tải lên: 18/06/2014, 15:20

6 427 0
Báo cáo hóa học: " The Armeo Spring as training tool to improve upper limb functionality in multiple sclerosis: a pilot study" ppt

Báo cáo hóa học: " The Armeo Spring as training tool to improve upper limb functionality in multiple sclerosis: a pilot study" ppt

... has barely been engaged as a training tool, certainly not with focus to functional capacity outcome Two studies have reported the usefulness of end-effector robots as assessment tools for quantifying ... technology enables stimulating as well as cost-effective practice, since it can be performed on a relatively autonomous and additional basis, also by a more disabled patient population as the one in the ... employed as a training tool assisting participants to additionally and independently practice task-oriented movements in a virtual real-life-like learning environment Importantly, significant gains...

Ngày tải lên: 19/06/2014, 08:20

8 679 0
Báo cáo lâm nghiệp: "Utilization of a dynamometric pendulum to estimate cutting forces involved during routing. Comparison with actual calculated values" pdf

Báo cáo lâm nghiệp: "Utilization of a dynamometric pendulum to estimate cutting forces involved during routing. Comparison with actual calculated values" pdf

... the tool s edge and never with its top (Fig 1) Normal and tangential cutting forces are measured with a piezoelectric dynamometers attached to the router table as shown Figure The resultant total ... table with its cutting forces measuring device – Straight edge: tooth with only one tooltip engaged; rake angle: 23°; clearance angle: 15° Each value of total cutting forces obtained is a mean ... Similar mechanical properties and machining tests were carried out, and allowed to validate these correlations [8] This provided validation for Movinghi and Ash; but application to Spruce was less...

Ngày tải lên: 08/08/2014, 00:22

7 324 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... effective measure we have to combat influenza is isolation and culling of infected fowls as demonstrated by the government of China, Vietnam, and Thailand As human populations continue to increase and ... as a protease to cleave HA which creates a systemic infection as well [1] Taubenberger [1] reported that this transformation was not observed in the1918 strain, or in strains “captured” in nature...

Ngày tải lên: 02/11/2012, 11:12

4 520 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

... a small food reward after the last evaluation session Samples The sample material was a fermented oat bran product (Yosaw, Bioferme, Finland), which is a cereal-based snack food similar to flavored ... pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than the regular aroma sample ... by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was anchored from ¼ weak...

Ngày tải lên: 03/04/2013, 21:06

10 599 1
Using eliciting question as a technique to teach english to 11th form pupils

Using eliciting question as a technique to teach english to 11th form pupils

... to help pupils understand the whole text such as a funny story Example: A tourist visiting a pub was fascinated by a stuffed lions head mounted on a mahogany plaque above a door behind the bar ... play a very important role in every classroom Teachers can create an active learning environment by encouraging students to ask and answer questions Some ideas to make student questions and teacher ... emphasizing less important material Phrase your questions carefully - Phrase your questions so that the task is clear to students Questions such as What about foreign affairs? not often lead to...

Ngày tải lên: 27/12/2013, 20:26

36 644 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

... Q279E a- galactosidase A residual activity in patient derived cells; thus, galactose was demonstrated to be first active-site-directed pharmacologic chaperone for a lysosomal storage disease Galactose ... ameliorate Gaucher disease 19 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Accelerated transport and maturation of lysosomal alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor Nat Med ... a- galactosidase A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as a possibility in GD Galactose administration increased...

Ngày tải lên: 18/02/2014, 16:20

7 507 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... differentially based on varying stabilities Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of ... have begun to investigate by phage-display the tolerance to substitution in the hydrophobic core of GB1 One goal of this study was to compare phage-based strategies to computational methods Based ... irrational, but that can be rapidly explored using a phage selection Design of a heavy chain antibody scaffold A conceptually similar approach was employed by Bond et al in the design of a camelid...

Ngày tải lên: 19/02/2014, 12:20

7 503 0
Tài liệu Using Proven Sales Techniques for Selling WorkKeys as a Solution to Business doc

Tài liệu Using Proven Sales Techniques for Selling WorkKeys as a Solution to Business doc

... friendly manner, graciously and courteously •  That you want to help them •  To see you as the solution to their problem, and not be seen as your problem •  To be treated as mature adults, not as children ... loves and loses and loves again a slyly dashing war profiteer as she struggles to protect her family and beloved plantation A pig raised by sheepdogs, learns to herd sheep with a little help A cynical ... because you get your work done quickly You like to sugarcoat unpleasant experiences and rationalize bad situations into good ones You have a propensity towards narcotic addiction Twisted Apart,...

Ngày tải lên: 19/02/2014, 14:20

48 484 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers ... et al assigned the shoulders present at 1117 and 1020 cm)1 to RNA and DNA, respectively [18] Classification by LDA Classification by LDA on spectra reduced by PCA PCA was performed on the training ... content This quantitative change was accompanied by qualitative modification, as the methyl/methylene CH3/CH2 ratio was found to increase significantly in these cells A nuclear magnetic resonance study...

Ngày tải lên: 21/02/2014, 03:20

6 555 0
Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf

Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf

... study on the Zambezi basin A. K Chapagain − February 2000 Water value flows: A case study on the Zambezi basin A. Y Hoekstra, H.H.G Savenije and A. K Chapagain − March 2000 The water value-flow concept ... Netherlands A. Y Hoekstra and A. K Chapagain – July 2006 22 Water’s vulnerable value in Africa P van der Zaag – July 2006 23 Human appropriation of natural capital: Comparing ecological footprint and water ... environmental indicators was freshwater, divided into two categories: freshwater quality and freshwater resources Indicators in this respect were wastewater treatment and gross abstractions per capita as...

Ngày tải lên: 06/03/2014, 21:20

46 962 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... enhance PYM-induced caspase activation and subsequent PARP cleavage (F) Effect of CA9 ASO on PYM-induced caspase activation on Tca8113 ⁄ PYM cells The relative activation of caspase shown was calculated...

Ngày tải lên: 06/03/2014, 22:21

13 565 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

... activation of kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase ... Immediately after treatment, the cells were cooled to °C and lysed Luciferase activity was measured as described in [48] Statistical analysis All data are expressed as mean ± SD Student’s paired t-test ... stress response: characterization of changes in cytoplasmic organelles, cytoskeleton, and nucleoli, and appearance of intranuclear actin filaments in rat fibroblasts after heat-shock treatment J Cell...

Ngày tải lên: 07/03/2014, 12:20

10 454 0
w