... predictors and the quality performance measures as a set of criterion variables 5.5.1 Basic concepts of Factor Analysis (FA) and Canonical Correlation Analysis (CCA) Factor analysis 29 Factor analysis ... created for each factor in the final solution regression method and used as input data for further canonical analysis 6.4 Data analysis with CCA 6.4.1 Canonical model, assumption and data examining ... standardized scores (z scores) are computed as a part of SPSS Descriptive procedure and they are added to the data in the Data Editor and are available for SPSS charts, data listings, and analyses...
Ngày tải lên: 13/04/2013, 10:33
Unit 13: Activities and the seasons
... rice mountains mountains and are river night are warm evening house Example yellow green green is cool afternoon hot morning beautiful trees the the very cold blue have flowers wear weather visit ... the + m a ? It’s + adj (thêi tiÕt) + (in the + m a) Practice: Hot / Summer Cold / Winter Warm/ Spring Cool / Fall Use the words in the box to write some sentences about the seasons in a year rice ... Spring Fall Summer Winter Pelmanism Hot Cold Fall Spring Warm Winter Cool Summer What’s the weather like in the summer ? Peter It’s hot It’s hot in the summer Lan Form: What’s the weather like...
Ngày tải lên: 29/06/2013, 01:27
Unit 13: Activities and the Seasons.
... books/fall Back Back Back FURTHER PRACTICE • You and your friend make a dialogue to talk about your activities in the different seasons HOMEWORK • Write each word to fill lines • Practice asking and ... 1.You/always/winter What you in the winter? We always play basketball • The boys/often/spring What the boys in the They often play volleyball spring? • 3.Nam’s family/ sometimes/fall What does Nam’s ... TV/spring Back They/ sometimes/ go to the movies / summer Back He/sometimes/play games / fall video Back Back They/ usually/swim/ summer Back We/always/ play soccer/Summer Back I/often/ read...
Ngày tải lên: 19/08/2013, 02:10
unit 13:activities and the seasons
... Spring Summer Having a picnic Playing soccer Fall Walking Winter Playing tennis Minh: What you in the spring? Ba: I always ride my bike What you do? Adverb of frequency: always, usually, often, ... go sailing in the winter … o1 x1 o2 x2 o3 x3 o4 Maths Music class class Drawing o5 o6 o7 o8 History class class Geograpy class n.g English class x6 x7 Physics class n.d class x.t x4 x5 Dacing ... •Form: • -What + / does + S + adv + + in the + season? -S + adv + V(s/es) + … * Use: Hỏi đáp hoạt động m a sử dụng trạng từ tần xuất Use adverb of frequency to ask and answer Example A: what you...
Ngày tải lên: 14/10/2013, 22:11
... and fruit snacks, breakfast cereals, popcorn, lunch kits, candy, carbonated and non-carbonated drinks, pasta, snack chips, and milk Superman and the Pirates characters appeared in ads on television, ... snacks, and breakfast cereals Animated characters from Cartoon Network programming appeared on labels and packaging for QSR children’s meals, fruit snacks, snack crackers, yogurt, macaroni and cheese, ... and teenagers are exposed to a great deal of advertising that may be targeted to a general audience comprised mainly of adults On average, more than two million teens watched American Idol, and...
Ngày tải lên: 18/02/2014, 07:20
UNIT 5. ONLINE FACILITATION LESSON 7. MANAGING MEMBERSHIP AND ROLESNOTE potx
... • asking subgroup facilitators to post updates and summaries to the main list; • making subgroup archives available to all participants; • listing all subgroups on the community web space Managing ... of praising postings (from newbies and old hands alike) that are particularly informative, supportive, or valuable in other ways Post affirming messages to the list, alike) that are particularly ... create a special news and Create a web space for announcements and news of interest to all groups or create a special news and announcement list announcement list • Ban all cross-posting • Ban all...
Ngày tải lên: 08/03/2014, 20:20
export promotion federal agencies activities and resources in fiscal year 1999 pptx
Ngày tải lên: 09/03/2014, 14:20
Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot
... 5¢-FAM-labeled 29 base DNA13-RNA4-DNA12 (5¢-AATA GAGAAAAAGaaaaAAGATGGCAAAG-3¢) and DNA15RNA1-DNA13 (5¢-AATAGAGAAAAAGAAaAAAGATG GCAAAG-3¢) with a 1.5 molar equivalent of the complementary DNA, ... TGGAATTCAGTGGTGGTGGTGGTGGTGCCGGTAC CAATTATCTAGGG-3¢ for RNH 2A- R; 5¢-ATATGAA TTCTCTCTAAGGAGATATACTTATGACCGTTTCCAA CATTGGG-3¢ for RNH2B-F; 5¢-GGGGAAGCTTCTA GTGGTGGTGGTGGTGGTGCTTACGTTTAAAAAAT CCATC-3¢ ... RNH2B-R; 5¢-ATATAAGCTTCTCTCAA GGAGATATACTTATGACCAAAGATGCCGTG-3¢ for RNH2C-F; and 5¢-GGAGCTCGAGTTAGTGGTGGTG GTGGTGGTGCTGATTTATGACATCGATGAGG-3¢ for RNH2C-R In these sequences, underlined bases show...
Ngày tải lên: 17/03/2014, 17:20
A guide for preparing, loading , and transporting poultry pdf
... http://www.nfacc.ca/ AVMA Guidelines on Euthanasia http://www.avma.org/issues/animal_welfare/euthanasia.pdf CFIA Health of Animals Regulations http://laws-lois.justice.gc.ca/PDF/C.R.C.,_c._296.pdf Loading ... utilizes anaesthesia produced by an agent that causes loss of consciousness and subsequent death “Euthanasia” originates from the Greek language: eu meaning "good" and thanatos meaning "death" Fatigue ... Producer practices prior to loading Cull - Euthanasia results in a quick death without pain or distress Acceptable Euthanasia Methods Unacceptable Euthanasia Methods Blunt force trauma to the head Physical...
Ngày tải lên: 23/03/2014, 21:20
TYPES AND ROLES OF FORMAL FINANCIAL INSTITUTIONS PROVIDING AGRICULTURAL CREDIT potx
... Muhammad Nejatullah Siddiqi, Il sistema bancario islamico: teoria e pratica Agricultural Training Manual 15 Islamic banks are limited liability joint-stock companies; shareholders manage the bank ... relaxed and both deposits and loans contracts are also offered to non-members Agricultural Training Manual • In many cases it is a growth and transformation process that leads an informal group ... Verlag Breitenbach Publisher, Saarbrücken, Fort Lauderdale, 1987 ∗ Siddiqi Muhammad Nejatullah, Il sistema bancario islamico: teoria e pratica, in AA.VV., Islam e finanza, Institute of Southeast...
Ngày tải lên: 29/03/2014, 09:20
Báo cáo khoa học: Ribonuclease H: properties, substrate specificity and roles in retroviral reverse transcription ppt
... Balakrishnan M, Palaniappan C, Fay PJ & Bambara RA (2000) Unique progressive cleavage mechanism of HIV reverse transcriptase RNase H Proc Natl Acad Sci USA 97, 11978–11983 Wisniewski M, Balakrishnan ... Balakrishnan M, Palaniappan C, Fay PJ & Bambara RA (2000) The sequential mechanism of HIV reverse transcriptase RNase H J Biol Chem 275, 37664–37671 Wisniewski M, Chen Y, Balakrishnan M, Palaniappan ... cleavage modes for retroviral RNases H DNA ⁄ RNA hybrids are drawn with RNA strands in red and DNA strands in black In the internal cleavage mode, the arrows mark the sites of cleavage along...
Ngày tải lên: 30/03/2014, 02:20
Báo cáo nghiên cứu khoa học " Strengthening Capacity in Forest Tree Seed Technologies Serving Research and Development Activities and ex-situ Conservation - MS5" pot
... participants A silvicultural trial was set up in a 6-year-old stand of A crassicarpa to study the impacts of thinning and fertilizer application on seed production The treatments have been laid ... of Acacia crassicarpa seed orchard in Dong Ha Four Vietnamese scientists to receive training in Australia in breeding strategy and seed orchard management in March/April 2006 RCFTI to nominate ... The database was installed into the computer at RCFTI and staff trained in its use An operations manual written in English was also provided Translation into Vietnamese is in progress While attempting...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Strengthening Capacity in Forest Tree Seed Technologies Serving Research and Development Activities and ex-situ Conservation - MS4 " potx
... ‘seed stand’ and ‘seed production area’ are generally referred to as A plus stand that is generally upgraded and opened by removal of undesirable trees and then cultured for early and abundant seed ... such as drought prone areas, may be unsuitable for seed production area Availability of pollinators can also be important (6) The area should be easily accessible The conversion of a stand into a ... properly managed and maintained to ensure full potential of seed production capacity Removal of cut material After thinning, it is necessary to remove all cut material that has accumulated on the...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Strengthening Capacity in Forest Tree Seed Technologies Serving Research and Development Activities and ex-situ Conservation " pptx
... income and living standards of rural people in lowland areas, particularly in central and central-northern Vietnam The area of eucalypt plantations Vietnam at the end of 2001 was estimated as 348 ... trials was available except a brief reference in Le Dinh Kha et al (200 3a) that some 11-year-old trees of Da Lat land races of E saligna and E microcorys were growing well at Lang Hanh, mean ... 13 Da Lat land race Vietnam Total 80 Table Seedlots of E camaldulensis from Australia and number of families represented in the main breeding population planted at Lang Hanh, Lam Dong, Vietnam...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Strengthening Capacity in Forest Tree Seed Technologies Serving Research and Development Activities and ex-situ Conservation " potx
... origin data and other relevant information pertaining to the seed i Operational data base adapted to RCFTI needs ii Staff able to master the data base applications i The seed database has been ... massive tree plantation program By 2010 it plans to establish an additional 5 million hectares plantations on cleared land, over and above the it plans to establish an additional million hectares ... development of a breeding strategy for eucalypts iii Data analysis completed iv Report on lab results v Trip report iii The Acacia crassicarpa progeny trial at Dong Ha was used for assessment and analysis,...
Ngày tải lên: 22/06/2014, 12:20
Unit 13 : Activities and the seasons
... play volleyball Pastimes - listen to music Wednesday, February 2010 A The weather and seasons Lesson 3: A 4,5 * Questions a What does Ba when it’s hot ? When it’s hot, he goes swimming b What ... Ba when it’s cold ? When it’s cold, he plays soccer c What does Ba when it’s cool ? When it’s cool, he goes jogging d What does Ba when it’s warm ? When it’s warm , he goes fishing What ... does Ba when it’s warm ? When it’s warm , he goes fishing What does Ba when it’s hot ? When it’s hot, he goes swimming What + / does ...
Ngày tải lên: 14/07/2014, 22:00
unit 6 bài 13 activities and the seasions
... like/likes + adj (hot/cool…) + weather Thursday, March 18th , 2010 * Ask and answer using: What weather + / does + S + like? I What weather you like? I like hot weather Hoa What weather does Hoa like? ... 3.Practice: * Ask and answer about Ba What does Ba when It’s + Adjective? When it’s + adjective, he + V( s/es) + O What does Ba when it’s Warm? When it’s Warm, he goes fishing What does Ba when it’s ... weather She What weather does she like? She likes cool weather They What weather they like? They like warm weather Thursday, March 18th , 2010 A Checking old lesson.: B New lesson: A4 -read...
Ngày tải lên: 15/07/2014, 15:00
ACTIVITIES AND THE SEASONS
... is hot summer? Ask and answer the questions about the weather A: What’s the weather like in the fall? B: It is cool Ask and answer the questions about the weather A: What’s the weather like in ... fall/ cool A: What’s the weather like in the fall? B: It’s cool d) winter/ cold A: What’s the weather like in the winter? B: It’s cold Ask and answer the questions about the weather Ask and ... weather Ask and answer the questions about the weather A: What’s the weather like in the spring? B: It is warm Ask and answer the questions about the weather A: What’s the weather like in the...
Ngày tải lên: 15/07/2014, 15:29