... analysis of the images at 12 h of treatment re-vealed a large number of cells with cytoplasmic caspase labeling, while at 24 h the number of caspase+ cells was low, but their labeling had a nuclear ... large amount of caspase+ cells at 12 h of CRET treatment However, in most of these cells the labeling has a cytoplasmic location, which indicates that said caspase is not active and, therefore, cannot ... caspase-3 to be active and capable of inducing apoptosis, it must translocate from the cyto-plasm to the nucleus The raw, non-normalized data, as illustrated by the images in Fig.4a, show a large
Ngày tải lên: 17/06/2020, 17:55
... f the WTO and VietnamCanada - Dairy and Canada - A ircraít it was consiđeređ that the use o f the tenn in Article 1.1 (a) was com prehensive rather than illustrative24 However, according to Article ... explanations that create the general principles to be used in cases For exam ple, in the case “Canada - M easures A ffecting the Export o f Civilian Aircraíìt”, the Appellate body o f the WTO affirm ... Regulations in intem ational trade has a signiĩicant m eaning in theory and practice, especially, w hen Vietnam is the official M ember o f the WTO 1.2 Purposes and tasks of the thesis The purposes
Ngày tải lên: 24/01/2021, 22:23
The subsidy regulations and vietnams position as a member of the WTO
... f the WTO and VietnamCanada - Dairy and Canada - A ircraít it was consiđeređ that the use o f the tenn in Article 1.1 (a) was com prehensive rather than illustrative24 However, according to Article ... explanations that create the general principles to be used in cases For exam ple, in the case “Canada - M easures A ffecting the Export o f Civilian Aircraíìt”, the Appellate body o f the WTO affirm ... Regulations in intem ational trade has a signiĩicant m eaning in theory and practice, especially, w hen Vietnam is the official M ember o f the WTO 1.2 Purposes and tasks of the thesis The purposes
Ngày tải lên: 16/02/2021, 14:40
Social cognition as a mediator of adolescent developmen
... awareness that ‘‘coolness is appearing socially attractive and available to others, but appearing too available means that I can’t attract friends on my own’’ With the onset of abstract systems at around ... example, as appraisals modulate affect, affect simultaneously provides feedback that selects, amplifies and organizesappraisal processes Changes in feeling tone take place as appraisal systems ... Trang 1Social cognition as a mediator of adolescent development: A coactive systems approach Michael F Mascolo and Deborah Margolis Merrimack College, North Andover, USA The study of social
Ngày tải lên: 12/10/2022, 08:48
IL-9 as a Mediator of Th17-driven Inflammatory Disease
... Trang 1Dartmouth College Dartmouth Digital Commons 6-19-2009 IL-9 as a Mediator of Th17-driven Inflammatory Disease Elizabeth C Nowak Dartmouth College Casey T Weaver University of Alabama, ... was isolated according to the manufacturer’s directions using RNAeasy (QIAGEN) RNA was ex-tracted from spinal cords, further treated with DNase using RNAqueous (Applied Biosystems), and transcribed ... presented, in the context of the emerging literature, establish that IL-9 cannot be readily assigned as being either a pro- or antiinflammatory cytokine Rather, its func-tion may be as an autocrine
Ngày tải lên: 21/10/2022, 15:22
Ebitda as a criterion for assessment of the banks system: The case of Deutesche bank, Generali and Unicredit
... the data were extrapolated from the budgets of the companies examined by the use of databases ABI, other data such as wages and salaries, to avoid distortions arising from the analysis of budget ... produce a major amount of the capital factor The three companies are analyzed: a German, namely Deutesche Bank and the other two Italian, namely Unicredit and Generali The research data comes from a ... comparable The data related to the reporting of the banks have been derived from the base data made available by the Italian Banking Association (ABI) With regard to the estimate of production
Ngày tải lên: 01/02/2020, 21:55
Clinical response and pharmacokinetics of bendamustine as a component of salvage R-B(O)AD therapy for the treatment of primary central nervous system lymphoma (PCNSL)
... Residual variability; SD: Stable disease; V: Volume of distribution; WBRT: Whole brain radiotherapy Availability of data and materials The dataset used and analyzed during the current study is available ... inter-individual variability was estimated in terms of the coefficient of variance (CV, %) The accuracy and ro-bustness of the final population model was evaluated using a non-parametric bootstrap analysis ... that bendamustine has modest clinical activity as single agent therapy against relapsed PCNSL with reasonable tolerability [11, 12] However, the effect of this agent as part of combination salvage
Ngày tải lên: 03/07/2020, 01:06
Exploring the influence of remote leadership competency on the outcome of virtual it service team the role of intra team communication as a mediator
... questionaire Servey Data analysis was conducted utilizing Smart PLS, focusing on the structural model's validity and reliability, as well as the validity of the exploratory factor analysis The subsequent ... testingHair et al (2011) emphasize the importance of analyzing the validity of measurement tools in research The internal correlation and total item's reliability test demonstrate that a set of scales ... investigate the association between the provided frameworks and the hypothesized relationships, as well as to grasp and modify such associations.Data collection instrumentsA comprehensive eight-part
Ngày tải lên: 25/03/2025, 10:41
Tài liệu The Man of Letters as a Man of Business docx
... 3Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist hehas been done a great deal already; and a commercial state like ours has really more ... rightalong," as the English boys at Oxford made an American collegian say in a theme which they imagined forhim in his national parlance; and the man of letters, as an artist, is apt to have ... when they can get the work.Their incomes are mainly from serial publication in the different magazines; and the prosperity of the magazines has given a whole class existence which, as a class, was
Ngày tải lên: 17/02/2014, 19:20
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... Thus, GAG activation of HC-II was Table 1. Second order rates of association (k ass ) values for the reaction of serpins with proteases in the presence and absence of a range of GAGs (values are representative ... future. Acknowledgements This work was supported by the National Health & Medical Research Council of Australia, the Austra- lian Research Council, the National Heart Founda- tion of Australia ... cardiovascular diseases such as deep vein thrombosis. Because many of the principal procoagulant compo- nents of the system are serine proteases, regulation of the system is principally by the
Ngày tải lên: 20/02/2014, 02:21
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt
... smoke, the main component of environmental tobacco smoke, burns off the end of a lit cigarette and is the smoke inhaled by passive smokers While the association between inhalation of mainstream smoke ... pickup rate was more sensitive to the gas than the particulate phase of mainstream and side-stream smoke solutions [129] Since pick-up rate decreased in sidestream smoke when beat frequency increased, ... nicotine, cadmium, and anabasine, all components of cigarette smoke, suppressed FSH induced expansion of the cumu-lus and decreased synthesis and accumulation of hyaluronic acid in the cumulus matrix
Ngày tải lên: 05/03/2014, 17:20
A Review of the Scientific Literature As It Pertains to Gulf War Illnesses-Volume 6 - Oil Well Fires potx
... increased numbers of lymphocytes in bron-choalveolar lavage fluid similar to that found in hypersensitive pneumoconitis It has been hypothesized that epithelial injury and permeability changes ... Trang 63Possible Health Effects of Oil Fires 43Table 3.5 Concentration of Elements Associated with PM in the Ambient Air (ng/m3) a United States Camp Thunderock (August 1991) in Swedish arsenic ... beryl-lium became widespread The environmental burden also increased as a result mod-of emissions from plants producing and processing beryllium or its alloys andcompounds The major exposure to beryllium
Ngày tải lên: 06/03/2014, 15:20
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx
... Pro136Leu, 8 h) After the chase ASA was immunoprecipitated from the homogenates with the polyclonal ASA antiserum Precipi-tated ASA was quantified after SDS ⁄ PAGE with a bio-imaging analyser (Fujifilm) ... Pro136Leu, 4.5 h) After the chase, ASA was immunoprecipitated from the homogen-ates with the polyclonal ASA antiserum Precipitated ASA was quantified after SDS ⁄ PAGE with a bio-imaging analyser (Fujifilm) ... investigated the influence of glucosidase and mannosidase inhibi-tion on the mutant ASAs (Gly86Asp, Tyr201Cys, Asp335Val, Pro136Leu, Asp255His, Thr274Met) In these experiments all of the mutant ASAs behaved
Ngày tải lên: 07/03/2014, 17:20
American Negro Slavery A Survey of the Supply, Employment and Control of Negro Labor as Determined by the Plantation Regime docx
... and the Levant And in the same general period Arab dhows began to take slave cargoes from the east coast of Africa as far south as Mozambique, for distribution in Arabia, Persia and CHAPTER I western ... particular sanction to slavery as well as to polygamy, the virtues of the negroes as laborers and as eunuch harem guards were so highly esteemed that the trade was maintained on a heavy scale almost ... 6: The leading authority upon slavery and the slave-trade in the Mediterranean countries of Europe is J.A Saco, Historia de la Esclavitud desde los Tiempas mas remotas hasta nuestros Dias (Barcelona,
Ngày tải lên: 08/03/2014, 00:20
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc
... amount of arachidonic acid determined for each assay of oxidase activation [12] The rate of O2 production by the activated NADPH oxidase was calculated from the rate of the superoxide dismutase-inhibitable ... contaminant [15] The identity of S100A8 was further ascertained by amino-acid sequencing, using Edman degra-dation As S100A9 has a blocked N-terminal amino acid, analysis of the protein was carried ... long-chain unsaturated fatty acids and, most particularly, arachidonic Fig 6 Effect of S100A8/A9 on the time course of oxidase activation. Oxidase activity was measured by the rate of O 2 uptake
Ngày tải lên: 18/03/2014, 01:20
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx
... within Canada and elsewhere as resulting from the ascendance of concentrated monopoly capitalism and corporate globalization Transnational corporations— many with home bases in the US—actively apply ... from our analysis that policies associated with the social welfare states of Denmark and Sweden are clearly beneficial to women and enhance their quality of life Yet, in Canada there is increasing ... inequality and poverty Ottawa: Status of Women Canada; 2001 [5] Day S, Brodsky G Women and the equality deficit: the impact of restructuring Canada’s social programs Ottawa: Status of Women Canada; 1998
Ngày tải lên: 22/03/2014, 11:20
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... normal epidermal and immor- talized keratinocytes, dermal fibroblasts, squamous cell carcinoma and five human melanomas. Thus, these data clarify in detail the cutaneous expression of the P450scc system; ... spectrometer. The LC/MS workstation CLASS -8000 software was used for system control and data acquisi tion (Shimadzu). Elution was carried out isocratically at a flow rate of 0.5 mLÆmin )1 and temperature ... isolated at the Albany Medical C ollege and stored at )80 °C. The skin and internal organs were harvested f rom f emale C 57BL/6 mice aged 8 weeks at telogen and anagen stages of the hair cyc le as described
Ngày tải lên: 23/03/2014, 13:20
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx
... promoting quality of life in older adults The data were collected by Statistics Canada under the authority of the Statistics Act Access to the data was granted by Statistics Canada based on a peer-reviewed ... Statistics Canada Classification of chronic conditions The respondents were asked to indicate whether they had a disease or another health condition diagnosed by a health professional that had ... based on full information maximum likelihood estimation (FIML) (available in the Mplus 4.2 [30] software package) by using all available data to assess whether the estimates may have been biased...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx
... [56] The mutant BCR–ABL tyrosine kinase activates several signalling pathways, including the ERK1 ⁄ pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of transcription ... extracellular signalregulated kinase ⁄ (ERK1 ⁄ 2) and protein kinase B (PKB) pathways that act downstream of oncogenic protein kinases [10,11] It is increasingly apparent that BIM as a mediator of tumour ... work we have had to omit because of space constraints Work in the Cook laboratory is funded by the Association for International Cancer Research, AstraZeneca, the Babraham Institute, the Biotechnology...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... simultaneously with antitubulin (DM 1A) and anti-actin (lanes and 2) Other samples were stained with antineurofilament protein (lanes and 4) The volume of each sample was adjusted to load a similar amount...
Ngày tải lên: 23/03/2014, 05:22