don t be creative with the technology

báo cáo khoa học: "Why don’t hospital staff activate the rapid response system (RRS)? How frequently is it needed and can the process be improved?" potx

báo cáo khoa học: "Why don’t hospital staff activate the rapid response system (RRS)? How frequently is it needed and can the process be improved?" potx

... function of the MET and pathways to access help These clinical areas are in turn situated within the complexity of the character of the institution itself One of the many potential factors that ... will be interviewed to determine why a MET call had not been made Data collected from these structured interviews will be used due to the time constraints of the study and potential to interrupt ... attitude [24] Aims of this study The aims of the proposed study are threefold: to establish the scope of the problem; to examine the barriers to calling the MET; and to pilot a redesign of the...

Ngày tải lên: 10/08/2014, 10:23

7 438 0
I haven''''t and I don''''t have- Khác nhau thế nào?

I haven''''t and I don''''t have- Khác nhau thế nào?

... (Tienganh.com.vn) ...

Ngày tải lên: 16/09/2013, 12:10

2 509 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

... 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third PCR was carried out using PCR products, the first PCR 5¢ primer and the second ... first PCR were: 5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGA CCCTACTCCAG-3¢ and 3¢ primer, 5¢-GGTTATCATA TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ ... 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen SSA (Eur J Biochem 271) 4077 TAAGGTGAAC-3¢) that had NcoI and BamHI restriction sites, respectively...

Ngày tải lên: 07/03/2014, 16:20

9 485 0
Don’t Be Taken for a Ride Guide to Auto Leasing pdf

Don’t Be Taken for a Ride Guide to Auto Leasing pdf

... financing the car and getting the best interest rate, knowing that the higher the interest rate, the more they will pay each month and, eventually, over the life of the deal A smart consumer not only ... interest rate will be The closer the four-digit decimal is to 0000, the lower the monthly payment will be The better your credit rating is, the lower you should expect the money factor to be Example: ... know the answer to the first Once you understand how the lessor sets the monthly rate, you can negotiate with the lessor on even footing Know the language of the industry The first step is to understand...

Ngày tải lên: 16/03/2014, 12:20

29 505 0
kelly - financially stupid people are everywhere; don't be one of them (2010)

kelly - financially stupid people are everywhere; don't be one of them (2010)

... buy anything they want with it, but you want at least two dollars back then they’re done Drive them to a store and watch the magic They look at prices, they look at their ten bucks, if they’re ... did that work? The end of the billing cycle happened on the 20th of each month I told the printer to charge the entire cost on the 21st The next credit card statement wouldn t be mailed until the ... telling them to buy trifles they don t need using debt they can t repay They stumble down the path paved by big business that transfers their income to corporate coffers They don t realize that the...

Ngày tải lên: 03/11/2014, 13:05

223 246 0
Tài liệu “Don’t spit in the well - you may need to drink from it!” -- Unknown, Russia. docx

Tài liệu “Don’t spit in the well - you may need to drink from it!” -- Unknown, Russia. docx

... especially fish that live in the water There has not been enough research to determine the effects that PPCPs can have on humans, but there is evidence to suggest that these chemicals may be partially ... increasing concentrations in lakes and rivers Scientists have discovered that many PPCPs act as hormone disrupters, which means that the synthetic hormones in the products interfere with the natural hormones ... http://www.epa.gov/glnpo/image/viz_iss2.html What impact does agriculture have on water pollution? The greatest agricultural contributions to water pollution are through nutrient and sediment pollution Livestock waste and fertilizers...

Ngày tải lên: 18/02/2014, 04:20

6 468 0
Don''''t oil the squeaky wheel docx

Don''''t oil the squeaky wheel docx

... Accept team members the way they are, not the way they ought to be • Catch team members doing things almost right and tell them about it • Discount team members’ weaknesses (We all have them; don t ... not! However, that is how most managers go about building their organizations They buy the best, or at least the latest, of everything and begin the implementation without a solid foundation, without ... painting looks different with a different frame) • Find the good in the bad See the story above • Tune into the triggers that cause you to feel bad Interrupt them or turn them off by substituting...

Ngày tải lên: 15/03/2014, 09:20

208 506 0
ORGANIZATIONS DON’T TWEET, PEOPLE DO - A Manager’s Guide to the Social Web

ORGANIZATIONS DON’T TWEET, PEOPLE DO - A Manager’s Guide to the Social Web

... organizations, or even move between departments, there is usually little to indicate what we did, why, and what the point was It was with the ultimate irony that in the week that I left the BBC ... systems with individual cells that know their role and work in relation to the cells around them without control from some active central authority We don t have to think about the important stuff ... yet They may only be in the heads of other people The best way to get access to that knowledge is through online conversations with the people themselves Sometimes you get direct access to the...

Ngày tải lên: 15/03/2014, 15:20

295 715 0
Báo cáo khoa học: The viral SV40 T antigen cooperates with dj2 to enhance hsc70 chaperone function docx

Báo cáo khoa học: The viral SV40 T antigen cooperates with dj2 to enhance hsc70 chaperone function docx

... all three types of complex in the cellular context This interpretation is supported by the finding that association of T antigen with dj2 prior to the addition of hsc70 leads to the recruitment ... (TAg ⁄ dj2 ⁄ hsc70) In contrast, the presence of the mutated form of T antigen was not able to change the folding activity of the hsc70 ⁄ dj2 chaperones In other words, despite the fact that the ... MA) into the BamH1 site of pGEX- 4T- 1 (AMRAD) to create the pGEX- 4T- 1–wtTAg construct The resulting plasmid was digested with EcoR1 and HindII, treated with Klenow and religated to create the pGEX- 4T- 1–wtTAg282...

Ngày tải lên: 16/03/2014, 05:20

7 315 0
Leadership the Hard Way: Why Leadership Can’t Be Taught and How You Can Learn It Anyway

Leadership the Hard Way: Why Leadership Can’t Be Taught and How You Can Learn It Anyway

... exaggerate the “existential threat” of terrorism to keep people in a state of constant anxiety; on the other, they promise perfect security—on the condition, of course, that the public support their ... in effect force people to anticipate in advance the potential threats facing the organization In this way, they become the catalyst for continuous adaptation that allows the organization to avoid ... night, the weather was fine But as we headed toward Athens, we encountered an unanticipated obstacle The air traffic controller at the Athens airport informed us that there were flight restrictions...

Ngày tải lên: 16/03/2014, 21:03

157 590 0
technology spontaneously approaching humanity with the passag

technology spontaneously approaching humanity with the passag

... which to draw Since the T8 00 and a replicant start identically in this way, we can treat the two as one and the same Therefore, the newly created T8 00 in Terminator could easily be substituted with ... their lives, they chose to pursue humanity, the moment they chose to hijack their transport shuttle In a similar way in Terminator 2, Skynet, the national defense's intelligent super computer "decided ... maintaining a strategic superiority over other powers, deciding the best strategy to assure its own survival was to eliminate all threats Like all the 'human' technology in these films, it grew...

Ngày tải lên: 21/03/2014, 22:52

4 294 0
The World That Couldn''''t Be pdf

The World That Couldn''''t Be pdf

... upon the ground, and looked into the hole There, at the bottom of it, was the Cytha It was the first time he'd gotten a good look at the Cytha and it was a crazily put-together thing It seemed to ... and stepped out from the tree, with the gun at ready What a perfect place to set a trap, he thought One would be looking at the pug marks, never at the space between them, for the space between ... handle it if he had to, although there was the danger that if he shifted it, the bole might settle more solidly and crush his foot beneath it At the moment, the two heavy branches, thrust into the...

Ngày tải lên: 23/03/2014, 00:20

43 385 0
Báo cáo Y học: Shb links SLP-76 and Vav with the CD3 complex in Jurkat T cells pptx

Báo cáo Y học: Shb links SLP-76 and Vav with the CD3 complex in Jurkat T cells pptx

... consequently how the activation of JNK is affected To further study the effects of the mutation in the Shb SH2 domain, we examined the proteins found to coprecipitate with Shb in Jurkat cells Except ... EcoRI, and ligated into EcoRI digested pGEX- 2T vector The SLP-76-Pro–GST plasmid was constructed using the primers 5¢-CGAGGGATCCCT GCAGAACTCCATCCTGCCTG-3¢ and 5¢-CATTTAAT GAATTCTCTTCCTCCGC-3¢ corresponding ... indicated, is given in the table below the blot The values are given relative the total amount of SLP-76 interaction and the binding could be blocked out with phosphotyrosine (Fig 4A,B) To identify...

Ngày tải lên: 24/03/2014, 04:21

10 412 0
w