... may affect patient trust including: the reputation of hospital, the process of admission, the clean of waiting room, the waiting time, the attention of doctors and nurses The result of qualitative ... It is easy to get appointments to specialists (doctors) in the X hospital It is easy to get appointments to specialists (doctors) in the X hospital I am easy to get appointments and the ... spent waiting for diagnostic tests and treatment, at the pharmacy, scan centers, blood banks and laboratories was reasonable FAC12 The waiting rooms, clinical and diagnostic test rooms are adequately
Ngày tải lên: 06/04/2017, 15:55
... post contrast imaging and the pre contrast images in the same axial plane using the software subtraction function avail-able on the post processing workstation Another useful post processing tool ... sequence with fat saturation was then performed in the transverse orientation using the parameters shown inTable 1 Then a bolus of gadopentetate dimeglumine (Gd-DTPA) (Magnavist, Schering AC Berlin, ... preparation includes informing the patient about the exam duration and the necessity to remain still to minimize the motion artifacts and mis-registration errors removing all ferromagnetic items
Ngày tải lên: 02/11/2022, 09:25
VALUE STUDY OF PLASMA CERULOPLASMIN mRNA AND FIBRINOGEN CHAIN A mRNA IN THE DIAGNOSIS OF HEPATOCELLULAR CARCINOMA
... TCATTCGTTTCGGAAGAGCGGCGGCGGCTGCTCGGGGGGCGTAC CTCGGGTTTCCGTCTTGCTGTATCGCTCGCTCGAGAACGCAAGTTCTGT TAACGTGAGTCTTGTAAACCTTCTTTTTACGTACTCTCGTGTTA AAAATCTGAATTCTTCTAGAGTTCCTCTGATCTTC Trang 102.2.4 Steps to proceed- Collect clinical and ... CTGGCATATCATGACATACGACCTGA- CTGCTTCTCAGATCCTCIC-Fo CGACGTAAAACGACGGCCAGT- ACTAGCGTGCCTTTGTAAIC-RO CTGGCATATCATGACATACGACCTGA- AGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTTATGTAC TCATTCGTTTCGGAAGAGCGGCGGCGGCTGCTCGGGGGGCGTAC ... Table 2.1 Sequence of primers, detection samples and internal Trang 9CP-Ro CTGGCATATCATGACATACGACCTGA-ACATGCTTCCCACGGFGA-Fo CGACGTAAAACGACGGCCAGT- GAGAGGCGATTTTTCCTCAGFGA-Ro CTGGCATATCATGACATACGACCTGA-
Ngày tải lên: 28/04/2025, 09:58
Philosophy in a New Key A Study in the Symbolism of Reason, Rite, and Art
... entities, to mathematical terms, working out the logicalresults, and then staging certain crucial experiments to checkthe hypothesis against the actual, empirical results But thefacts which are accepted ... intellectual harvest, to be reaped in the nextseason of the human understanding.2 Symbolic Transformation The vitality and energies of the imagination do not operate at will; they are fountains, ... years of philosophical growth, beginningwith the early Church Fathers and culminating in the greatScholastics But, at last, its generative ideas—sin and salvation,nature and grace, unity, infinity,
Ngày tải lên: 14/03/2014, 17:25
A walk in the Garden of Eden Genetic Trails into our African Past pptx
... allthe DNA that exists in the nucleus of the cell of a human beingtogether with the small amount of DNA that exists in themitochondria the tiny organelles that are found in the cytoplasm of these ... health insurance companies The state may claim that it, too, has an interest in this information – if it might result in reducing the escalating health care budget, for example Forensic DNA databases ... evolution.The thread that connects us biologically with our ancestry is stored in the human genome The genome that carries the biochemicalinstructions that determine inherited traits contains an indeliblerecord
Ngày tải lên: 15/03/2014, 02:20
Once Upon A Time in the Italian West: The Filmgoers' Guide to Spaghetti Westerns
... ‘international appeal’ Another one of the films’ main selling points was their national casts – a fact that was mentioned constantly in their trailers multi-If there was one thing the European ... quarries atMagliana, the landscape of Manziana around Bracciano Lake, the Abruzzo NationalPark and the Nature Reserve at Tor Caldara The most distinctive spaghetti western locations were in Spain ... thesurrounding area, including the rock formations at La Pedriza (in the GuadarramaMountains), the reservoir at Santillana and the landscape of Manzanares El Real Trang 19The Andalusian province of Almeria
Ngày tải lên: 15/03/2014, 18:39
A Plum In The Syrup pptx
... change to an instant fortune at his fingertips Trang 27The law of attraction states that we attract everything we receive in life through our internal energy vibrations (the energy you put out ... property appraisals, lining up new financing to pay off the note and all other facets of the transaction was neatly laid out After attending this Trang 6seminar, short selling real estate seemed simple ... cannot be reconciled as just good luck – again, the law of attraction says there is no such thing According to the law of attraction the question ultimately lies in what is particular to this man’s
Ngày tải lên: 16/03/2014, 21:20
Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot
... theoretical approach The simulation was started by stating the metabolic pathways from ATP to Ino (Fig 3), writing the opportune differential equations (Fig 4) and solving them with the help of the MATHEMAT-ICA-3.0 ... Aliquots were taken at the indicated times and analyzed by HPLC In (B) application of the theoretical model was performed with the MATHEMATICA -3.0 program, as described in the text and in [3] The ... conditions that we considered pertinent (based on the literature) to render linear formation of products The results obtained and the kinetic constants taken from the literature are compiled in Table
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... 5¢-GGCCATTGGCTGGCCTTaatGCACAGCGGATCG ATTTTC-3¢; MREc mut, 5¢-CCAGTACAGTGTCGG AGCattCCAGCGCGAGGTGGCCG-3¢; MREd mut, 5¢-CGGGAGGACGGCGGCGCattACTTTGAATCAT CCGTG-3¢ Mutations in the MREs were identified and confirmed ... with a biotin head at the 5¢-end HepG2 nuclear extracts were incubated with avidin–agarose beads (Sigma) at 4C for 30 min to eliminate materials in the extracts that bind nonspecifically to the ... promoter activity Further investigation is needed to elucidate the exact reason why the most distal MREa from transcription start site is important for activity, especially in a TATA-less promoter
Ngày tải lên: 17/03/2014, 23:20
THE FIRST BANK OF THE UNITED STATES - A CHAPTER IN THE HISTORY OF CENTRAL BANKING pdf
... bank said that the Constitution did not grant the government the authority to establish banks Still others thought that a national bank would have a monopoly on government business, to the detriment ... money The size of its capitalization made the First Bank not only the largest financial institution in the new nation but also the largest corporation of any type by far The bank’s sale of shares ... had the authority to inspect the bank’s condition but was allowed to do so no more than Indeed, the bank and the Treasury had a close relationship It was Hamilton, acting as Treasury secretary,
Ngày tải lên: 22/03/2014, 21:20
AMERICAN HERO-MYTHS. A STUDY IN THE NATIVE RELIGIONS OF THE WESTERN CONTINENT potx
... was such that he personally appeared among the ancestors of the nation, and taught them the useful arts, gave them the maize or other food plants, initiated them into the mysteries of their religious ... reasonable doubt but that here again otosis and personification came in and gave the form and name of an animal to the original simple statement That statement was that from wet mud dried by the ... friendly and favorable to the welfare of man than the other The better of the two, the true hero-god, is in the end triumphant, though the national temperament represented this variously At any rate,
Ngày tải lên: 22/03/2014, 22:20
Episode 13 A wedding in the air docx
... thing about getting married HECTOR Yeah, love NICK No – no! The Stag Night! HECTOR The what? NICK The Stag Night It’s when the bridegroom – that’s you, is taken out by his best man, that’s me to ... yeah ANNIE [Composing email] Nadia I really want a small wedding, but Hector’s mother keeps interfering ANNIE She must not interfere, it’s too much! BRIDGET [Composing email] I don’t have any ... voy! Donatella Versace está por llegar de un momento a otro Tiene ideas maravillosas para mi traje para la boda ¡Hasta pronto! Sound of telephone receiver being put down MRS ROMERO Gracias, Antonio
Ngày tải lên: 23/03/2014, 00:20
Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot
... part and the biotin-binding domain in the C-terminal part [5] The b-subunit is an integral membrane protein with nine membrane-spanning a-helices and a fragment inserting into the membrane but ... contains the carb-oxyltransferase domain in its N-terminal portion and the biotin-binding domain in its C-terminal portion The c-subunit plays a profound role in the assembly of the complex It interacts ... complex stability To investigate whether one of the histidine residues of the histidine triplet at the C terminus of c-2 is import-ant for the interaction with a-2, each histidine was mutated individually
Ngày tải lên: 23/03/2014, 13:20
History of Cuba; or, Notes of a Traveller in the Tropics pdf
... better than a dead letter [3] Here Leo X erected the first cathedral in Cuba Baracoa is situated on the north coast, at the easternextremity of the island, and contains some three thousand inhabitants, ... of the steamer was instantly altered; but all on board momentarily expected the apparition of a warsteamer from the channel between the Moro and the Punta It appeared, afterwards, that the Pampero ... days afterwards that it wasascertained that Crittenden's party, attempting to leave the island in launches, had been made prisoners by aSpanish man-of-war They were taken to Havana, and brutally
Ngày tải lên: 24/03/2014, 03:21
ICT enabled independent living for elderly: A status-quo analysis on products and the research landscape in the field of Ambient Assisted Living (AAL) in EU-27 doc
... states and three associated states Along with this joint programme, a network of national contact points has been set up with the potential to perform some international coordination of AAL approaches ... ratios that easily, as they only represent the current status on the market Just like in the case of the influence of the degree of technological maturity and marketability, statements about the ... treated and monitored within their domestic environment The great advantage of tele-medical applications is that the patients do not have to move to a medical institution to be monitored and treated
Ngày tải lên: 28/03/2014, 16:20
Báo cáo hóa học: " Targeting the inflammation in HCV-associated hepatocellular carcinoma: a role in the prevention and treatment" pptx
... (DEN)-inducedHCC) in rats Gallic acid treatment significantly attenuated some alterations (i.e increased levels of aspartate transaminase, alanine transaminase, alkaline phosphatase, acid phosphatase, lactate ... TRIF (TIR-domain-containing adapter-inducing interferon-b) join-ing the RIG-I/MDA5 pathway In the other pathway, TLR7 senses single-strand HCV RNA and via the MyD88 adaptor protein activates IRAK4/IRAK1 ... domain-containing adaptor inducing IFN (TRIF) TRIF is an adaptor protein that is a critical component of the TLR3 signaling pathway By cleaving IPS-1 and inactivating TRIF, HCV disrupts the ability
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " The assessment of health-related quality of life in relation to the body mass index value in the urban population of Belgrade" potx
... data presenta-tion MM completed the interpretation of data GSM car-ried out a critical revision of the manuscript for important intellectual content JT was involved in administrative and technical ... interests Authors' contributions NV did the study concept and design SR participated in data integration and data analysis accuracy JM and NK were responsible for statistical analysis and data ... the factors leading to increased body weight and obesity and, consequently, to the impairment of health-related quality of life Competing interests The authors declare that they have no competing
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: "Research Article Harnack Inequality for the Schrödinger Problem Relative to Strongly Local Riemannian p-Homogeneous Forms with a Potential in the Kato Class" potx
... al [2] gave an analitical proof of the result in the case of elliptic operators with bounded measurable coefficients Citti et al [3] investigated the case of the subelliptic Laplacian and in 1999 ... for both the arguments of the form [6,13], but in the nonlinear case the property holds only for the second argument Trang 5We list now the assumptions that give the relations between the topology, ... a Harnack inequality for the Schr¨odinger problem rel-ative to strongly local Riemannian p-homogeneous forms with a potential in the Kato class The first result in the case of Laplacian has been
Ngày tải lên: 22/06/2014, 22:20
Báo cáo toán học: "A Discontinuity in the Distribution of Fixed Point Sums" pps
... asymptotic enumerative situation in which thoughts of Trang 3discontinuities might be far from the mind of an investigator, yet they materialize in an interesting and important way A quick explanation ... and the last term is entire Thus only the first term matters asymptotically Hence we obtain asymptotic estimates for Gn and Gn,k that differ from those for all permutations by a factor of 2 Thus ... = {a1 < a2 < }. At first, deciding the truth or falsity of (i) in a particular instance may seem trivial Not so, however • Permutations in which elements in the same cycle must have the
Ngày tải lên: 07/08/2014, 07:21
Báo cáo y học: "Is there a dysfunction in the visual system of depressed patients" pptx
... cerebral stratum, while their axons ter-minate in the lateral geniculate body It is obvious that the part of the optic nerve from the retina to the chiasm con-stitutes only a part of the optic ... 2 minutes in dark Generally, the standing potential of the eye mani-fests a diurnal rhythm, similar to that of the body temperature It seems that after 15 minutes of adaptation to darkness, the ... retina During the adaptation of the retina to dark, the amplitude of the EOG gradually decreases, reaching a nadir (dark trough) During the adaptation to light (ganzfeld, 1200 lux) it gradualy
Ngày tải lên: 08/08/2014, 21:20