displaying the string value for part of a date

... obtained by various authors in the country, analyzing the advantages and disadvantages of these methods of bioclimate classfication so that the author can select most appropriate classification ... Assessement of bioclimatic resources and other natural factors for development of agricultural crops and forest trees with economic value is the scientific basis for the rational spartial arrangement of ... terms of nature, economy and politics During the past several years, the area has always been regarded as a rich potential for developing agro- forestry and areas specializing in the growing of

Ngày tải lên: 29/08/2014, 15:53

... Press and the authors All rights reserved 410 D.Q Nguyen et al / A robust transformation-based learning approach using ripple down rules for part-of-speech tagging automatically learns transformation-based ... Recently, statistical and machine learning-based POS tagging methods have become the mainstream ones obtaining state-of-the-art performance However, the learning process of many of them is time-consuming ... in the tree is a rule A rule has the form: if α then β where α is called the condition and β is called the conclusion Cases in SCRDR are evaluated by passing a case to the root of the tree At any

Ngày tải lên: 12/12/2017, 10:48

... & Nguyen Huy Tuan a a Department of Mathematics and Applications , Saigon University , 273 An Duong Vuong, Ho Chi Minh City , Vietnam b Department of Mathematics , University of Natural ... PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform However, Taylor ... on the given data Thus, an appropriate regularization method is required The backward problem for the parabolic equation has been studied using many methods in the last four decades There has

Ngày tải lên: 16/12/2017, 01:20

... protein) at a unmanipulated oxygen (UO) period and a unmanipulated (MO) period as mean of measured vales from 10AM-2PM (= day values) and 10PM-2AM (= night values) Day and night data was used from the ... Canadian Journal of Fisheries and Aquatic Sciences 71, 1447-1458 Barrut, B., Blancheton, J.P., Champagne, J.Y., Grasmick, A., 2012 Mass transfer efficiency of a vacuum airliftApplication to water ... Norway I’m very grateful to Stefan Marx, Saskia Heckmann, Pompeo Moscetta and Enrico Savino for a well cooperation in terms of analyzer performance and support for presenting the collected data

Ngày tải lên: 27/09/2019, 10:31

... from the relevant protective laws and regulations and therefore free for general use The publisher, the authors and the editors are safe to assume that the advice and information in this book are ... Comparing Approaches The Review of Financial Studies 22 (1): 435-480 Porporato, M and E Werbin 2012 Evidence of sticky costs in banks of Argentina, Brazil and Canada International Journal of Financial ... true and accurate at the date of publication Neither the publisher nor the authors or the editors give a warranty, express or implied, with respect to the material contained herein or for any

Ngày tải lên: 08/01/2020, 09:51

... years after the initial melanoma diagnosis (Bradford et al 2010) Risk of recurrence (i.e that the melanoma will spread to another part of the body) is related to the clinical features of a person’s ... (ACIM) 2010; Australian Institute of Health and Welfare & Australasian Association of Cancer Registries 2012) Once a melanoma has been detected, the risk of devel-oping another melanoma is much ... Melanoma de-tected at an early stage has a 5-year survival rate of greater than 90 %; however, this decreases to around 50 % with diagnosis at a late stage (Balch et al 2009) In Australia, the burden

Ngày tải lên: 10/01/2020, 13:13

... or phrase (A, B, C or D) that fits the blank space in the following passage: O’Henry’s real name was William Sydney Porter He was born in North California, the USA in 1862.His father was a doctor ... 29.Choose the correct sentence in each set A.Dick appears having a lot of money B.Dick appears to have a lot of money C.Dick appears have a lot of money D.Dick appears to having a lot of money ... teaching experience gives her an when working with children A.advantage B.advantages C.disadvantage D.disadvantages II.Choose the word or phrase (A, B, C or D) that fits the blank space in the

Ngày tải lên: 13/04/2021, 17:02

... local languages and then, most commonly, it was a colleague who“back translated” the translation One of the GRACE-01 coordinating team then checked the back translation against the original English ... work package had its own lead and coordinating team to manage the studies or tasks contained in their work package (for example the GRACE-01 coordinating team was located in Cardiff and the GRACE ... responsible and accountable for the integrity of the study [6] A social run or walk, called the“Race for GRACE” at a later annual study meeting, facilitated relationship building and relaxation PCN

Ngày tải lên: 01/11/2022, 09:07

... noncommutative residue for manifolds with boundary In [15, 16], we gave an operator-theoretic explanation of the gravitational action for manifolds with boundary and proved a KastlerKalau-Walze type theorem ... derived a formula for the gravitational part of the spectral action for Dirac operators on 4-dimensional spin manifolds with totally antisymmetric torsion and this is a perturbation with three forms ... brute-force proof of this theorem In [6], Kalau and Walze proved this theorem by the normal coordinates way simultaneously In [7], Ackermann gave a note on a new proof of this theorem by the heat

Ngày tải lên: 02/11/2022, 08:51

... based on the combination of an ESL approach for the mechanical displacement and a sublayer approximation for the electric potential is presented for the static and dynamic analysis of a piezoelectric ... classification of the various models is mainly based on the kinematic assumption for approximating the through-the-thickness variation of the electromechanical state variables and representation ... 2002 [4] R P Khandelwal, A Chakrabarti, and P Bhargava, “An efficient hybrid plate model for accurate analysis of smart composite laminates,” Journal of Intelligent Material Systems and Structures,

Ngày tải lên: 02/11/2022, 08:52

... proposed a new automated method of calculating the normal reference value (N-value) for use as the denomination of T/N This method uses voxel-based analysis of FDG- and MET-PET images We compared the ... mode and mean voxel values were calculated as tentative MET N-values (4) Applying the same coordinates to FDG-PET, the voxel values were averaged and used as tentative FDG N-values (5) The threshold ... PET Miwako Takahashi1 · Tsutomu Soma1,2 · Akitake Mukasa3 · Keitaro Koyama1 · Takuya Arai1 · Toshimitsu Momose1  Received: October 2016 / Accepted: 12 January 2017 © The Author(s) 2017 This article

Ngày tải lên: 19/11/2022, 11:47

... of author information is available at the end of the article Trang 2work (e.g., job behavior and job attitudes), health (e.g., physical and mental health and health behaviors) as well as quality ... were then used to determine the number of factors to retain EFA was repeated with removal of addi-tional items loading below 0.40 until an acceptable vari-ance was achieved Phase 2 data analysis ... enough useable data for the analyses The sample was primarily male (79%), white (60%), and had worked in corrections an average of 15 years (SD = 5.2) (Table 1) Sample population 3 Sample population

Ngày tải lên: 29/11/2022, 00:39

... Assessment, Social Services Abstracts, Sociological Database, Web of Science, CINAHL, COCHRANE, Applied Social Sciences Index and Abstracts and Database of Abstracts & Reviews of Effects The searches ... using the realist approach for this review was a key strength The philosophical underpin-nings of realist synthesis focus on theoretical depth, breadth and transferability, rather than a quantitative ... inclu-sion of other fields (education and policing) in the search to seek data about similar mechanisms of action We hope that future application of realist methodology can draw on our account of the approach

Ngày tải lên: 04/12/2022, 14:54

... two available party packages—the full package and individual items—parents can tailor the experience to their preferences, ensuring a memorable birthday for their kids and family Additionally, ... Image 1: The image introduces the campaign and the current state of the environment Image 2: Campaign activities: Clean up trash, and plant trees (Starting a campaign with KFC staff to get images ... to maintain the unique taste and nutritional quality of their dishes, adhering to corporate standards The global CHAMPS program, which emphasizes Cleaning, Hospitality, Accuracy, Maintenance,

Ngày tải lên: 05/02/2025, 11:07

... 5¢-gagagattt gctttgcgggttatggatctgc-3¢; mutation K201A, 5¢-gttatggatctgct accgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctg ctacttcgctccgatcctaaacgc-3¢; and mutation M453A, 5¢-ggacaa ctttgaatgggcggagggttatattgag-3¢. ... to the sense strand are listed, as follows: mutation E190A, 5¢-caacgagcctagagcgatttgctttgagg-3¢; mutation E190Q, 5¢-caa cgagcctagacagatttgctttgagg-3¢; mutation E194A, 5¢-gagagattt gctttgcgggttatggatctgc-3¢; ... Supplementary material The following supplementary material is available online: Fig S1 SDS-PAGE of the purified mutant Sfbgly This material is available as part of the online article

Ngày tải lên: 18/02/2014, 17:20

... protein sequence. Angle, the calculated angle between the helix axis and the plane of a model membrane. ASA, accessible surface area. +, the peptide has an adequate mean surface accessibility ‡ ... hydrophilic segregation (i.e. the amphipathicity) of the helices. The mean surface accessibility of the predicted epitopes on the Iris 3D structures was calculated by averaging the accessible surface area of the ... Radioactivity was measured using a gamma counter (LKB, Wallac, Finland). All animals were maintained and handled according to local and national ethical guidelines. Animal model of septic shock Two

Ngày tải lên: 07/03/2014, 01:20

... recovery in the labour market than described The combination of the bursting of the housing bubble and the world financial crisis has had a substantial impact on the endowment of labour and capital in ... and gas prices have been the subject of considerable interest in the wake of a particularly volatile year in 2008 which saw a nominal peak of over $140 per barrel in July of that year, with a subsequent ... presents a qualitative summary of these six impact areas to be considered in the context of what high oil and gas prices would mean for Ireland 14 THE ECONOMIC IMPACTS FOR IRELAND OF HIGH OIL AND GAS

Ngày tải lên: 08/03/2014, 06:20

... Primers 5¢ATF2-Kan 5¢-AGACTTTCAAACGAATAATAACTT CAGCAATAAAAATTGTCCAGGTTAATtccagcgacatg gaggccc-3¢ and 3¢ATF2-Kan: 5¢-TTGTACGAGCTCGG CCGAGCTATACGAAGGCCCGCTACGGCAGTATC GCAcattcacatacgattgacgc-3¢ (nucleotides ... DNA by amplification using oligonucleotides lip1 (5¢-atagacacgcaaacacaaatacaca cactaaattaataatgaccggatcATGTACTTCCCCTTTTTAGG CAGAT-3¢) and lip2 (5¢-cagtagagacatgggagatcccccgcgg aattcgagctcggtacccgggTCATTCTTTATTTAGAGCATC ... Trang 1Critical role of the plasma membrane for expression of mammalian mitochondrial side chain cleavage activity in yeast Catherine Duport1,*, Barbara Schoepp1,†, Elise Chatelain1, Roberto

Ngày tải lên: 08/03/2014, 08:20

... years, e.g Data Exchange Wales initiative (DEWi) data, information from primary schools via the transition plan, gender-specific data and the national core data set information Find school data ... about the learning environment as soon as possible • If appropriate, share the ideas put forward with SMT/other teachers/Heads of Department as part of a whole-school approach • Request a regular ... special school and/or the appropriate head(s) of department in a secondary school, a member of the school’s senior management team (SMT) or the LA advisory team, or a tutor in initial teacher training...

Ngày tải lên: 10/03/2014, 05:20

... H2SO4 and the absorbance was measured at 450 nm Quantification of each cytokine (in ngÆmL)1 for IFN-c and in pgÆmL)1 for IL-12p70) was performed based on the standard curve in each assay Preparation ... )76) of the mouse iNOS promoter plus the downstream 47 base pairs, designated NF-jBd (5¢-CAT GGG GAC TCT CCC TTT GGG AAC AGT TAT GCA AAA TAG CTC TGC AGA GCC TGG AGG GGT CGA-3¢) [12] and the IRF-1 ... (5¢-GGA AGC GAA AAT GAA ATT GAC T-3¢) were constructed as probes for EMSA The oligonucleotides were annealed and labeled with [32P]dCTP[aP] Binding reactions were performed (20 lL of the total volume)...

Ngày tải lên: 17/03/2014, 10:20