... enterprise Large owner Hired manager Significance of differences 0.000 b Independent (autonomous) enterprise Status of the JSC general director % by line 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 Total 4 81 278 ... 2006, p 13 ) Information arrays, available for experts, are related to specific groups of companies, such as, for example, a study of Rachinsky (2002) based on a sampling of 11 0 large Russian enterprises, ... intensity of a company’s modernization and restructuring The main trends for the formation of a cohort of CEOs and managerial teams are discovered on the basis of a comparative analysis of independent...
Ngày tải lên: 20/06/2014, 23:20
... am grateful to Naohito Abe, Tatiana Dolgopyatova, Victoria Golikova, Satoshi Mizobata, Heiko Pleines, Fumikazu Sugiura, and Andrei Yakovlev as well as participants of the Joint Workshop of Japan ... indicator is the profitability (ratio of profit to sale) and returns on asset (ROA) indicators obtained on the basis of companies’ book reports from SKRIN and SPARK databases .10 The AVEPRO and ROAAVE ... indicators is justified by previous 9780230_ 217 287 _11 _cha09 dd 219 5 /14 /2009 11 :06 :15 AM 220 Organization and Development of Russian Business experience of an empirical analysis of Russian companies’...
Ngày tải lên: 20/06/2014, 23:20
Báo cáo y học: " Decorin and TGF-β1 polymorphisms and development of COPD in a general population" ppt
... (12 ) (0) 13 6 (89) 10 (11 ) (1) 0.733 Decorin rs 111 06030 CC CA AA 996 (87) 14 2 (12 ) (1) 17 0 ( 91) (8) (1) 0. 217 Decorin rs1803343 AA AG GG 10 79 (94) 69 (6) (0) 17 3 (93) 13 (7) (0) 0.507 Abbreviations: ... pulmonary disease Am J Respir Crit Care Med 19 98, 15 8 :19 51- 1957 Pons AR, Sauleda J, Noguera A, Pons J, Barcelo B, Fuster A, Agusti AG: Decreased macrophage release of TGF-{beta} and TIMP -1 in ... transforming growth factor-beta1 production, fibrotic lung disease, and graft fibrosis after lung transplantation Transplantation 19 98, 66 :10 14 -10 20 Imai K, Hiramatsu A, Fukushima D, Pierschbacher...
Ngày tải lên: 12/08/2014, 16:20
Provision, discovery and development of ubiquitous services and applications
... such as CoBrA [11 ] and CASS [12 ], the context data acquired from data sources (e.g sensors) is usually stored in a central place and managed via a DBMS This approach is useful for efficient data ... Realization Layer (Application Context Engine) Service Management Layer (Location-Aware Service Provision and Discovery Platform) Data Access Layer (DBMS, Middleware) Data Layer (Application Data, Context ... Pervasive Patterns and Applications (PATTERNS), pp 227–232, Athens, Greece, 2009 11 Jian Zhu and Hung Keng Pung, A Pragmatic Approach to Context-aware Service Organization and Discovery , In Enabling...
Ngày tải lên: 10/09/2015, 08:36
Tài liệu Báo cáo khoa học: Role of hydroxyl group and R/S configuration of isostere in binding properties of HIV-1 protease inhibitors docx
... B of the complex of HIV- 1 protease with OE inhibitor 0.05 11 21 31 41 51 61 71 91 81 Residue number B factor 80 chain A 60 40 20 0 11 21 31 41 51 61 71 81 91 20 40 chain B Fig The complex of HIV- 1 ... regions of Ramachandran plot ˚ average B for main chain atoms (A2 ) ˚ average B for side chain atoms (A2 ) 15 16 50 15 9 0 .18 0 .18 0.24 0. 011 1. 8 92.4 30 .1 31. 5 Ó FEBS 2004 HIV- 1 Protease Inhibitors ... between protease and inhibitor As an indicator of these hydrophobic interactions, distances between carbon atoms of inhibitor and the protease ˚ ˚ were calculated using cutoffs of 3.6 A and 4 .1 A [19 ]...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Optimization of P1–P3 groups in symmetric and asymmetric HIV-1 protease inhibitors pptx
... (National Cancer Institute, Bethesda, MD, USA) The protease gene was isolated by PCR with the upstream primer GAACA TATGGCCGATAGACAAGGAACTGTATCC and the downstream primer AGGGGATCCCTAAAAATTTAA ... 1. 87 1. 81 1.87 1. 81 1.87 1. 81 2 .18 –2 .10 2.07–2.00 1. 97 1. 90 24.6 1. 81 19.0 21. 8 16 77 24.0–2.30 18 .1 20.0 16 62 24.6–2. 01 18.0 20.3 16 47 27.9 1. 81 18.8 222.4 16 97 22.6 1. 81 19.4 23.4 16 94 15 .0 1. 81 ... Asp 12 5 Asp 12 7 Gly 12 9 Asp 12 9 Asp Compound 25 Asp 25 Asp 27 Gly 29 Asp 48 Gly 12 5 Asp 12 5 Asp 12 5 Asp 12 7 Gly 12 9 Asp Compound 25 Asp 25 Asp 27 Gly 12 5 Asp 12 5 Asp 12 5 Asp 12 7 Gly 12 9 Asp 12 9...
Ngày tải lên: 08/03/2014, 02:20