dialog control in a natural language system

A Natural Language Human Robot Interface for Command and Control of Four Legged Robots in RoboCup Coaching

A Natural Language Human Robot Interface for Command and Control of Four Legged Robots in RoboCup Coaching

... goal area Search Goal The robot searches for the goal Reach goal The robot walks toward its goal Figure Goalie State Machine b Attacker The attacker is described by a state machine as shown in ... of the pair is encoded in a predicateargument format in the Scene Event Array (SEA) The SEA is also a x 25 array that encodes meaning in a predicate-argument representation In this example the ... ViaVoice TM) was used, such that each narrated event generated a well formed pair A Figure Attacker State Machine Platform In a previous study, we reported on a system that could adaptively acquire

Ngày tải lên: 19/10/2022, 02:51

10 1 0
Báo cáo khoa học: " Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. I. Spatial variation" pot

Báo cáo khoa học: " Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. I. Spatial variation" pot

... irregular concentric bands on a comparatively dark background (figs 4A, B) These bands were paratracheal axial parenchyma of the confluent type In general, band spacing varied gradually, increasing ... irregular bands, the spacing of which varied gradually, increasing and decreasing alternately These widely- and narrowly- spaced parenchyma bands differentiated various wood layers The radial enlargement ... Seasonal variations in the cambial anatomy of Tectona grandis (Verbenaceae) Nord J Bot 1, 535-542 Rogers S (1981) Seasonal variation in radial growth and phloem activity in Terminalia ivorensis A

Ngày tải lên: 08/08/2014, 23:22

14 435 0
Báo cáo khoa học: "Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. II. Terminal growth, lateral growth and main stem-branch growth correlations" ppsx

Báo cáo khoa học: "Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. II. Terminal growth, lateral growth and main stem-branch growth correlations" ppsx

... mature T catappa but according to other authors (Hallé and Oldeman, 1970 writing about T catappa; Maillard, 1987; Maillard et al, 1989 writing about young T superba grow- ing in a controlled glasshouse), ... radial growth was increased during March and after, in the equivalent parts of main stems Growth of a For an tree T "decapitated" plant unknown reason, the main apex of died During February and ... 198 7a) Besides terminal growth, lateral growth is also described, ie the appearance of axillary shoots and dynamics of branching, as well as radial growth of both main stems and branches In addition,

Ngày tải lên: 08/08/2014, 23:22

20 448 0
Biofilm formation and control in a model drinking water distribution system with phosphorus addition

Biofilm formation and control in a model drinking water distribution system with phosphorus addition

... FORMATION AND CONTROL IN A MODEL DRINKING WATER DISTRIBUTION SYSTEM WITH PHOSPHORUS ADDITION FANG WEI NATIONAL UNIVERSITY OF SINGAPORE 2010 BIOFILM FORMATION AND CONTROL IN A MODEL DRINKING WATER ... disinfectants and oxidants guidance manual Van der Kooij, D (1990) Assimilable organic carbon (AOC) in drinking water 175 References In: McFeters, G .A (Ed.), Drinking Water Microbiology Springer-Verlay, ... DWDS has a potential to increase the bacterial cell number and deteriorate the drinking water quality In the biofilm control study, free chlorine and monochloramine were used as disinfectants

Ngày tải lên: 11/09/2015, 09:17

199 587 0
The logistical challenges to implement the environmental management system in a natural gas company in the north region

The logistical challenges to implement the environmental management system in a natural gas company in the north region

... potential impacts are to be mitigated This includes zoning, creating reserves and increasing governance in a variety of ways, including deforestation licensing and control programs, as well as heavy ... environmental agency of the state and municipality, in addition to the Brazilian Navy In this line of reasoning, Viana [21] states that 56.6% of Brazilian cities had initiatives aimed at recycling materials ... they are hazardous and non-hazardous, being classified as class I and II waste Regarding common waste destinations (class I and II), Amazonas and other Northeast and Southeast regions carry it

Ngày tải lên: 11/10/2022, 16:25

14 10 0
Pastured Poultry Raising Chickens in a Grass-Based System docx

Pastured Poultry Raising Chickens in a Grass-Based System docx

... Pastured Poultry Raising Chickens in a Grass-Based System Erin Campbell-Craven, Livestock Program Assistant Kerr Center for Sustainable Agriculture What is Pastured Poultry? Pastured ... chicks in trailers – “Home base” will decrease roaming • Put chicks on pasture as young as possible – Acclimate to weather before summer • Place wire panels on either side of ramp leading to trailer ... individually caught and manually placed inside the trailers – Too stressful for birds • Already over 100 degrees in beginning of June – couldn’t shut birds up inside trailers to acclimate • Roamed widely

Ngày tải lên: 17/03/2014, 10:20

64 274 0
Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx

Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx

... glycolytic pathway. Much effort has already been invested in mathematical modelling of the glycolytic pathway in yeast [3–8] and in other organisms, such as Trypanosoma brucei, the parasite that causes ... state, and over a much wider range of operation than that for which the model was originally intended. It has been suggested [17] that inductive, multivariate and machine learning approaches are ... transport system (unlike the low affinity system) acts so as to maintain a constant intracellular supply of glucose, and constant Fig. 6. A plot of C PFK HXT and C PFK PFK against limiting rates

Ngày tải lên: 17/03/2014, 11:20

11 534 0
Báo cáo " Student writing process, perceptions, problems, and strategies in writing academic essays in a second language: A case study " docx

Báo cáo " Student writing process, perceptions, problems, and strategies in writing academic essays in a second language: A case study " docx

... spent a lot of time reading the books again and again. Hai also revealed in the informal talk after this interview that he did not have experience in writing academic essays like this one in ... Journal of Science, Foreign Languages 24 (2008) 184-197 190 database, and a chain of evidence (Yin [25]) and adopting a systematic and comprehensive data analysis scheme has helped increase ... Vietnam Received 19 May 2008 Abstract. When studying in Australia, international students in general and Vietnamese students in particular meet many difficulties, one of which is writing academis

Ngày tải lên: 22/03/2014, 10:20

14 589 0
Central Bank Interest-Rate Control in a Cashless, Arrow-Debreu economy: a comment on Wallace pptx

Central Bank Interest-Rate Control in a Cashless, Arrow-Debreu economy: a comment on Wallace pptx

... rate rules or justifying a role for the central bank Nominal magnitudes are nominal in name only and Wallace’s analysis is without theoretical foundations It generates a series of conceptual and ... central bank and interest rate control in the cashless, Arrow-Debreu economy is of no analytical or theoretical significance What the central bank does in this world, assuming that it can in fact ... exchange function is introduced, via a cash -in- advance or in- arrears constraint, money appears to be a welfare reducing innovation or a friction when history and common sense tells us that money

Ngày tải lên: 22/03/2014, 17:20

21 221 0
From the Critics’ Corner: Logic Blending, Discursive Change and Authenticity in a Cultural Production System* potx

From the Critics’ Corner: Logic Blending, Discursive Change and Authenticity in a Cultural Production System* potx

... enabling accurate profit calculations. In essence, formal ratio- nality is a set of ideas and orientations that guide market behaviour in modern capitalism. In sharp contrast to formal rationality, ... Blending, Discursive Change and Authenticity in a Cultural Production System* Mary Ann Glynn and Michael Lounsbury Emory University, Atlanta, GA; University of Alberta abstract Drawing on an analysis ... museums in Canada). Market and aesthetic logics are akin to Weber’s two types of rationality: formal and substantive. Formal rationality is ‘the extent of quantitative calculation or accounting which

Ngày tải lên: 30/03/2014, 16:20

25 509 0
Báo cáo lâm nghiệp: "C and 15 N isotopic fractionation in trees, soils and fungi in a natural forest stand and a Norway spruce plantation" pps

Báo cáo lâm nghiệp: "C and 15 N isotopic fractionation in trees, soils and fungi in a natural forest stand and a Norway spruce plantation" pps

... volatilization, the gas has a lower δ15 N than ammonium remaining in the soil [37, 40] In heavily manured farmland, ammonium volatilization may induce a large increase in δ15 N of the remaining nitrogen ... et al Figure Discrimination among ectomycorrhizal sporophores in the Breuil forest according to δ13 C and δ15 N, (A) natural stand, all sporophores, (B) natural stand, mean and standard deviation ... Russula fellea, R frag = R fragilis, R mair = R mairei, R och = Russula ochroleuca, R puel = R puellaris, A cit = Amanita citrina, A musc = A muscaria, A rub = A rubescens A horizon Presumably, carbon

Ngày tải lên: 07/08/2014, 16:21

11 320 0
Báo cáo khoa hoc:"Body size reaction norms in Drosophila melanogaster: temporal stability and genetic architecture in a natural population" docx

Báo cáo khoa hoc:"Body size reaction norms in Drosophila melanogaster: temporal stability and genetic architecture in a natural population" docx

... emerging adults) was obtained as a consequence of a large number of parents (50 females) directly laying in a single vial for a few hours Data were analysed with the Statistica software [43] As in ... chromosome rearrangements or allozyme frequencies, with in most cases an adaptive interpretation [27] For quantitative traits, investigations on natural populations have mainly demonstrated spatial genetic ... 1999) Abstract - A natural population of Drosophila melanogaster was sampled twice over 5-year interval from the same French locality in the same season Reaction norms of wing and thorax length and

Ngày tải lên: 09/08/2014, 18:21

18 221 0
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx

Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx

... centrifugation at 14,000 rpm for 15 minutes to separate into an aqueous RNA phase, an organic protein layer and a DNA interphase RNA was extracted by adding 0.5 ml isopropanol to the aqueous phase and ... Gambia Full list of author information is available at the end of the article infectious diseases as young adults[1,2] By splitting the year in half, seasonal fluctuations are taken into account, ... in alternating seasons of relative food availability and low infectious diseases burden (harvest/low infection; January to June) and deprivation and high infectious diseases (hungry/high infection

Ngày tải lên: 10/08/2014, 05:21

11 527 0
báo cáo khoa học: " Transcription profiles of mitochondrial genes correlate with mitochondrial DNA haplotypes in a natural population of Silene vulgaris" doc

báo cáo khoa học: " Transcription profiles of mitochondrial genes correlate with mitochondrial DNA haplotypes in a natural population of Silene vulgaris" doc

... TCGACGTGTCGAAGTGAAAG; AtpA1170R: TCTGAGCCAAATTGAGCAAA) DNA nucleotide sequences of the cox1 and atp1 coding regions were determined for the maternal plants and a few representative progeny from each family ... PCR-RFLP haplotype was not present in maternal plant even in trace amount, and if (3) it differed in all mt markers analyzed, which made paternal inheritance more parsimonious explanation than substoichiometric ... with an extra band as intense as the major bands were found among 39 siblings in the Kov45 family and 20 individuals with an extra band slightly fainter than the major bands were found among

Ngày tải lên: 12/08/2014, 03:21

11 166 0
Báo cáo y học: "Enrichment of intersubtype HIV-1 recombinants in a dual infection system using HIV-1 strain-specific siRNAs" pps

Báo cáo y học: "Enrichment of intersubtype HIV-1 recombinants in a dual infection system using HIV-1 strain-specific siRNAs" pps

... examp le, in East Africa, intersubtype A/ D, A/ C, and D/C recombinant forms are almost as common as the parental subtype A, C, and D [8]. These URFs and CRFs have the potential to foil vaccine ... recombinants and the ongoing pare ntal strain r eplica- tion. In the study presented herein, use of dual siRNA treatment inhibited the replication of parental strains, and only 126D/12 0A recombinants ... 19:303-308 35 Artenstein AW, VanCott TC, Mascola JR, Carr JK,... 102:9002-9007 Quinones-Mateu ME, Gao Y, Ball SC, Marozsan AJ, Abraha A, Arts EJ: In vitro intersubtype recombinants of human immunodeficiency

Ngày tải lên: 13/08/2014, 01:20

12 251 0
Báo cáo y học: " Evolution of the uniquely adaptable lentiviral envelope in a natural reservoir host" potx

Báo cáo y học: " Evolution of the uniquely adaptable lentiviral envelope in a natural reservoir host" potx

... viral evolution. Viral load quantification for five naturally infected sooty mangabeysFigure 1 Viral load quantification for five naturally infected sooty mangabeys. Viral RNA in plasma obtained ... PAP ST.PVK KP SNL NL T T SAP.T T AAQ.INGSS ITY .S.E AAAP.P KA SL R A N T A T SL YN .S.E AAA T AKA SL R PAP ST.PVK S .S.E AAA T S .S.E AGA T K DC I.Y P A GI T SL RYN .S.E .A AAA T ... primer pair amplified a 421 bp fragment spanning the V1–V2 hypervariable region of envelope. The gag region was amplified using shortgagF1 (5'TTAAGTCCAAGAA- CATTAAATGC-3') and shortgagR

Ngày tải lên: 13/08/2014, 09:21

14 266 0
Báo cáo sinh học: "Association among quantitative, chromosomal and enzymatic traits in a natural population of Drosophila melanogaster" pptx

Báo cáo sinh học: "Association among quantitative, chromosomal and enzymatic traits in a natural population of Drosophila melanogaster" pptx

... Original article Association among quantitative, chromosomal and enzymatic traits in a natural population of Drosophila melanogaster M Hernández, JM Larruga, AM González, VM Cabrera ... females from a natural population of Drosophila melanogaster of the Canary Islands was simultaneously examined for wing length, inversion polymorphisms, and gene variation at ... and morphological variation seem to indicate that, as in experimental populations, a negative correlation between genetic heterozygosity and morphological variance also exists in natural

Ngày tải lên: 14/08/2014, 19:22

20 351 0
Báo cáo sinh học: "Seasonal fluctuations of cosmopolitan inversion frequencies in a natural population of Drosophila melanogaster" pot

Báo cáo sinh học: "Seasonal fluctuations of cosmopolitan inversion frequencies in a natural population of Drosophila melanogaster" pot

... Original article Seasonal fluctuations of cosmopolitan inversion frequencies in a natural population of Drosophila melanogaster F Sanchez-Refusta* E Santiago J Rubio Universidad ... collected in the afternoon. Females inseminated in nature were kept individually in vials, and salivary gland chromosomes from a single larva of the progeny of each vial were ... trapping period were D melanogaster, D immigrans and D simulans. D melanogaster was dominant in June and July, but D simulans increased rapidly, becoming most abundant

Ngày tải lên: 14/08/2014, 20:20

10 199 0
Báo cáo sinh học: "Second chromosome polymorphism of Drosophila buzzatii in a natural population is not associated with gametic selection and does not affect mating pattern" potx

Báo cáo sinh học: "Second chromosome polymorphism of Drosophila buzzatii in a natural population is not associated with gametic selection and does not affect mating pattern" potx

... et al (1991) in a Spanish natural population of D buzzatii. However, our analysis is based on the assumption that the offspring of each wild inseminated female was fathered ... remaining individuals in the bottles were maintained until pupation in order to estimate larval viability by counting all pupae. Further collections were performed in A ... of Drosophila buzzatii in a natural population is not associated with gametic selection and does not affect mating pattern C Rodriguez 1 E Hasson JJ Fanara JC Vilardi 2 ! GIBE,

Ngày tải lên: 14/08/2014, 20:20

16 198 0
GAS PRODUCTION FROM METHANE HYDRATES IN a DUAL WELLBORE SYSTEM

GAS PRODUCTION FROM METHANE HYDRATES IN a DUAL WELLBORE SYSTEM

... Cheah, Kang Zi Han, Brandon and Samantha Chin, Magdalen Ng, Dominic Cooray, Paul Chen, Carmelita Leow, Jared Wong, Kelvin Seet, Marianne Tan, Aaron Leng, Lydia Goh, Trina Tan, Rachel Soh, Frances ... Nankai Trough in Japan, the Messoyakha field in Siberia, Eileen in Alaska, Mallik site in Canada’s Mackenzie Delta and the Tiger Shark in the Gulf of Mexico. The largest outcrop of natural gas ... hydrates formed in seawater, which are no doubt equally as important as methane hydrates are almost always found in oceanic conditions. As seen in Figure 1.8, the available data on methane hydrates formed

Ngày tải lên: 01/10/2015, 17:26

128 379 0

Bạn có muốn tìm thêm với từ khóa:

w