... to an increase in the rate of the initial fast phase, i.e. oxidation of the a chains. The rates of oxidation are reduced in the presence of chelators of heavy metal cations in most cases. An ... oxidation mediated by the smooth LPS was less affected by the presence of EDTA. The rough S. minnesota LPS increased the initial fast phase of the reaction, but decreased the rate of the slow phase ... 3A. The rate of auto-oxidation of cross-linked Hb was greater than that of Hb A 0, both in the presence and absence of EDTA, as has been observed previously [17]. In addition, the rates of auto-oxidation...
Ngày tải lên: 08/03/2014, 10:20
... music has made him a citizen of the world. He has played in almost every major city. Download this story as a PDF He has won many Grammy awards for his recordings. He has also won Emmy awards ... his playing so special. They say he is able to communicate the joy he feels in playing, and the emotions that great music can deliver. Anyone who has attended a performance by Itzhak Perlman will ... Itzhak Perlman: a citizen of the word, with his violin as a passport STEVE EMBER: Many consider him the greatest concert violinist in the world. The music of Itzhak Perlman is our program today...
Ngày tải lên: 11/03/2014, 15:38
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau-for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC 78772–78800 79013–78981 NC_000077 Idem STOP-for STOP-rev AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG 210–237 657–631 NC_000073 ... Idem Doublecortin-for Doublecortin-rev CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG 705–728 967–943 NM_010025 Idem LIS1-for LIS1-rev CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG 1288–1303 1427–1407 NM_95116 Idem Tubulin a6 -for Tubulin a6 -rev AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 6854–6876 7646–7624 NC_000081 ... Quı ´ mica Biolo ´ gica, Facultad de Ciencias Quı ´ micas, Universidad Nacional de Co ´ rdoba, Argentina 2 Departamento de Biologı ´ a Molecular, Facultad de Ciencias Exactas, Fı ´ sico-Quı ´ micas...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo y học: "Practices of entomophagy and entomotherapy by members of the Nyishi and Galo tribes, two ethnic groups of the state of Arunachal Pradesh (North-East India)" potx
... to a patient. Wasps have also been reported as parts of the folk medicine of various Latin and South American cultures [37,38], as well sub- Saharan Africa, where they are often associated with strength ... Pakistan, Ceylon, Burma and Malaya. Coleoptera Lamellicornia - Lucanidae and Passalidae. Volume IV. Today and Tomorrows Printers and Publishers; 1949:1-274. 29. Atkinman ET: Fauna of Himalaya ... insect consumption. Larval stage is highly esteemed. Apis cerana Apidae Honey bee Tangik, (G) Tungu (N) Nov-Jan Adult and larval stages are consumed roasted and in form of a paste. Wings and antennae are discarded. Preferred...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: "Changes in regional distribution of lung sounds as a function of positive end-expiratory pressure" potx
Ngày tải lên: 13/08/2014, 16:20
computational and experimental analyses of transcriptional regulation as a function of dna sequence
Ngày tải lên: 14/11/2014, 06:05
the subsidy regulations and vietnam’s position as a member of the wto
Ngày tải lên: 18/08/2014, 12:35
Reading Theory as a Microcosm of the Four Skills
... unfortunately, are dominated by the grammar-translation method of language teaching, where, as often as not, English is only taught as a means to accessing literature, be it classical, technical ... any teacher is the task of knowing his clients. The notion of needs analysis is absolutely central. Even with as few details as we have outlined above, there are certain things that we can assume ... to, and do, participate in. This group will be familiar to many EFL teachers as they are the backbone of many schools in Ireland and Britain. One of the most important initial tasks for any...
Ngày tải lên: 06/09/2013, 10:10
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
... Georgetown, Texas. 25. Brunk, U.T. & Terman, A. (1999) The mitochondrial-lysosomal axis theory of cellular aging. Understanding the Basis of Aging: the Roles of Mitochondria, Free Radicals, and Antioxidants (Cadenas, ... maintenance. Mitochondria are the main source of ROS formation, as well as the main target for free radical attack. The accumulation of defective mitochondria within aging cells suggests that some are not properly autophagocytosed. Aged ... explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic errors [26,27]. Adequate support for...
Ngày tải lên: 17/03/2014, 23:20
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart. References Argue, J. (2000) Parkinson’s disease and the art of ... Responses The tango group stated on the exit questionnaire what they liked best and least about the program. They greatly appreciated the camaraderie and socialization engendered by the program. Being ... press the wand backwards (arms still behind chair). e. Finger roll: As fast as you can, then as slow as you can; Rolling out to the sides of the wand, and back to center. Come up with your own plan! From...
Ngày tải lên: 28/03/2014, 20:20
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx
... indicate whether they had a disease or another health condition diagnosed by a health professional that had lasted, or was expected to last, 6 months or more. These data were used to classify the ... mediation as the percentage of the total effect that could be attributed to the indirect effect. The SAS 9.1 software package [29] was used to obtain the maximum likelihood estimates for each of the ... those based on full information maximum likelihood estima- tion (FIML) (available in the Mplus 4.2 [30] software package) by using all available data to assess whether the estimates may have been...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx
... the premature release of unassembled viral RNA. It may also enhance virus packaging as it appears that the assembly of coronavirus occurs intracellularly, probably in the intermediate compartments ... between the endoplasmic reticulum and Golgi apparatus [24]. Clearly, this has certain advantages for the virus at certain stages of its life cycle. In addition, a reduction in the cell surface expression ... human coronaviruses, Table 1: Amino acid sequences of the cytoplasmic tail of spike (S) proteins of coronaviruses are compared with the YxxΦ (where x is any amino acid and Φ is an amino acid...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
... complex and the initiation of intracellular signaling events regulating oxi- dase assembly and activation has been described [31,32]. The NADPH oxidase The phagocytic NADPH oxidase plays an essential ... production of these free radicals can damage tissue adjacent to the sites of inflammatory action; therefore, the activation of the NADPH oxidase is tightly controlled though regulated assembly of the ... Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's dis- ease brains. Biochem...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo vật lý: "The Hidden Property of Arrhenius-type Relationship: Viscosity as a Function of Temperature" doc
... bukan dalam bentuk asas. Persamaan baru ini mengekalkan sifat asal tenaga keaktifan dan kelikatan pada suhu tidak terhingga, dan ia merangkumi pemalar baru, iaitu kelikatan pada suhu sifar. ... Nisbah kelikatan pada suhu sifar dan kelikatan pada suhu tidak terhingga merupakan nilai asas untuk pemalar tenaga keaktifan. Model ini telah diuji dengan enam minyak sayur-sayuran dan kejituannya ... temperature, rheology Abstrak: Dalam penulisan ini, satu persamaan untuk menggantikan hubungan jenis Arrhenius telah diterbitkan. Ini adalah kerana pemalar tenaga keaktifan daripada persamaan...
Ngày tải lên: 07/08/2014, 14:20
Báo cáo khoa học: "Bioavailability of the amino acid-attached prodrug as a new anti-HIV agent in rats" pdf
...
Ngày tải lên: 07/08/2014, 23:22
Báo cáo khoa học: "Evaluation of the fullerene compound DF-1 as a radiation protector" doc
... irradiator and mice were irradiated with the indicated total body doses. A 137Cs Gamma Cell 40 (Nordion International, Kanata, Ontario, Canada) was used as the ionizing radiation source. The ... times and sta- tistical analysis was done using a student's t-test. Data are presented as mean ± SD. A probability level of P < 0.05 was considered significant. Statistical analyses of lethality studies ... capacity that may provide a clinically translatable method of radiopro- tection. Methods Cell Lines and Treatment The MiaPaCa2 (pancreatic adenocarcinoma) and DU145 (prostatic adenocarcinoma) cell...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: "Compressive stenosis of the left hepatic vein as a pathogenesis of postresectional liver failure: a case report" potx
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: "Cornual pregnancy as a complicaton of the use of a levonorgestrel intrauterine device: a case report" pdf
Ngày tải lên: 11/08/2014, 14:20