... CENTRAL ADMINISTRATIVE SUPPORT DEPARTMENTS INFORMAL CONFLICT MANAGEMENT PROCEDURE ADMINISTRATIVE OFFICIAL: DELEGATED AUTHORITY, RESPONSIBILITY, AND AREAS OF POTENTIAL RISK ACADEMIC AND RESEARCH AFFAIRS ... Officials to design? ? and? ? implement programs and? ? practices that establish an ethical environment and? ? improve financial accountability and? ? control. Each Administrative Official ... (i.e., monthly) to ensure that charges? ?and? ?credits are valid and? ? that adequate supporting documentation is available. D A? ?method to determine? ?and? ?document the cause of significant deviations. E A? ?method? ?for? ?taking corrective actions that include:
Ngày tải lên: 29/03/2014, 20:20
... repugnant to many people Same-sex lovers planning to adopt face additional potential barriers: • state laws barring adult adoptions—Alabama, Arizona, Hawaii, Michigan, Nebraska and Ohio all... ... Fred was a friend and colleague of Hayden’s,... are many similar experiences in being a lesbian and being a gay man (calling a lesbian a ‘Dyke’ and calling a gay man a ... sodomy law Maryland No sodomy law Massachusetts Heterosexual and homosexual sodomy illegal 20 years Michigan Heterosexual and homosexual sodomy illegal 15 years Minnesota Heterosexual and
Ngày tải lên: 18/04/2014, 14:03
báo cáo hóa học: "A binary method for simple and accurate two-dimensional cursor control from EEG with minimal subject training" potx
... separability, and identified the more effective channels and frequency bands for control We calculated each Bhattacharyya distance according to (1), where Mi and Σi are the mean vector and covariance ... implement the paradigm within OB's software system for EEG data acquisition and processing TAK also assisted with data collection, performed the data analysis, and drafted and revised the manuscript ... one male, with ages ranging from 24–55 years Subject A was female, age 53 years Subject B was female, age 55 years Subject C was female, age 24 years Subject D was male, age 32 years We also carried
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and jitter metrics" potx
... RESEARCH Open Access Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and jitter metrics Masahiro Hiyama 1* , Elis Kulla 1* , Tetsuya Oda ... function. We can save the data for these parameters in a text file and can Figure 2 Horizontal obstacle topology scenarios. A: HOS, B: HOM. Hiyama et al . Human-centric Computing and Information Sciences ... several fields such as collaborative computing and communications in indoor areas. Mobility and the absence of any fixed infrastructure make MANETs very attractive for mobility and rescue operations
Ngày tải lên: 21/06/2014, 06:20
báo cáo hóa học:" Research Article A Formal Model for Performance and Energy Evaluation of Embedded Systems" pot
... estimation A tool, named PECES, was implemented for automatizing the method Additionally, a measuring platform, named AMALGHMA, was constructed for characterizing the platform and for comparing ... The AMALGHMA (Advanced Measurement Algorithms for Hardware Architectures) tool has been implemented for automating the measuring activities AMALGHMA adopts a set of statistical methods, such as ... executed, measured, and then the obtained data were statistically analyzed For example, to capture the average power consumption when a MAM miss occurs, an assembly code that forces MAM misses was designed
Ngày tải lên: 21/06/2014, 11:20
báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx
... SR1D4F TAGAATTCGTGAGCAGATCATGT DNA-shift assay P D4 SR1D4R TAGAATTCCATTGTGAACCATC SD2R1F TAGAATTCATCGCCACGACCATG DNA-shift assay P R1 SD2R1R TAGAATTCCGCGGTTCGGCAGA simX5D3F TAGAATTCTGTACAAGGCCTGGT ... TAAAGCTTCAAAACGGGGTGAAC DNA-shift assay P A7 simA7R ATAAGCTTGTCGATACCGATCTTC PEx2F ACTTCCCAGAAGTA DNA-shift assay P Ex2 PEx2R AGAGGGCAGTAGAC PR3F TTTCTAGATGCACCCGATCCTC DNA-shift assay P SR3 PR3R GAACAGGATTCGCATGAGTACT ... TAGAATTCTGTACAAGGCCTGGT DNA-shift assay P D3 simX5D3R TAGAATTCGCGACAGGAGCCATA simEXX4F TAGAATTCGACGCCTTCCAGTC DNA-shift assay P X4 simEXX4R TAGAATTCTCAGAACATCGTCC SR2ExXF AAATCTAGATCAAGCCAGTGCTG DNA-shift assay P
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: " Research Article ASAP: A MAC Protocol for Dense and Time-Constrained RFID Systems" pdf
... Tag transmits Command errors Collision ACK command is ‘0’ Successful: ACK command is ‘1’ Silent - ID Reader command, ACK command Reader command, ACK command Kill command Destroyed Figure 2: ASAP: ... per- formance deteriorates, although not significantly, as the dif- ference between the optimal and offered frame size increases. [...]... ASAP to variants of ASAP, that is, p-ASAP, m-ASAP, and ASAP ... “identified” state and negatively acknowl- edged tags transition to the “activated” state. Subsequent to the transmission of the “ACK command,” the reader broad- casts a new “reader command” and a new
Ngày tải lên: 22/06/2014, 19:20
Báo cáo hóa học: "Research Article A Generalized Algorithm for Blind Channel Identification with Linear Redundant Precoders" pot
... above, we summarize here a general guideline to choose a set of optimal param- eters in practice. (1) When the channel is constant and for a fixed Q,alarger J appears to have a better performance ... general beat the time domain approach for a random channel, it has been consis- tently observed that frequency domain approach performs better than time domain approach wh en the last channel ... Minn, USA, April 1993 [14] B Su and P P Vaidyanathan, Generalized signal richness preservation problem and Vandermonde-form preserving matrices,” to appear in IEEE Transactions on Signal Processing...
Ngày tải lên: 22/06/2014, 23:20
building a sustainable business a guide to developing a business plan for farms and rural businesses
... Within each Planning Task, the four key functional planning areas are addressed: marketing, operations, human resources and finances In Planning Task One, you and your planning team (family, ... plan Your evaluation of alternative strategies for your farm and your efforts to persuade others that the strategy... grower and marketer located in Princeton, Minnesota Frank had operated ... Minars’ primary planning objective was to evaluate on-farm milk processing as a. .. You may want to begin by team member and then determine what values you share as a team If you are
Ngày tải lên: 27/07/2014, 22:53
báo cáo khoa học: "The behaviour change wheel: A new method for characterising and designing behaviour change interventions" pps
... educational materials) and organisational interventions (local consensus processes); ‘financial’ includes individual and organisational incentives and environmental restructuring (changing the available ... in place for a specified behavioural target to be achieved?’ The ‘intervention mapping’ approach is based on an epidemiological analysis of co-variation within the behavioural domain and starts ... behaviour change wheel: A new method for characterising and designing behaviour change interventions Susan Michie1*, Maartje M van Stralen2 and Robert West3 Abstract Background: Improving the design
Ngày tải lên: 10/08/2014, 10:23
Báo cáo sinh học: "Mapping Quantitative Trait Loci (QTL) in sheep. III. QTL for carcass composition traits derived from CT scans and aligned with a meta-assembly for sheep and cattle carcass QTL" pot
... quantitative trait loci for growth and carcass traits in a complex... Afolayan RA, Crawford AM, Bottema CDK: Quantitative trait loci for live animal and carcass composition ... nterest across multiple studies for fat, muscle and weight trai ts, specifically for fat on OAR2 (BTA2) and OAR6 (BTA6), for muscle QTL on OAR2 (BTA2) and for weight on OAR1 (BTA1), 6 (BTA6) and ... stimated by a veraging the area of muscle at the closest image to the first lum- bar and the next caudal image. Percentages of lean, fat and bone were calculated as a percentag e of the carcass
Ngày tải lên: 14/08/2014, 13:21
The future of finance a new model for banking and investment
... inaccurate The same was true for MBSs Rating agencies had applied quantitative analysis and statistical modeling as... financial markets Banks and investors are better advised to learn the lessons ... crash and adopt policies and processes that mitigate the effects of the next crash, rather than think that they can avoid its impact altogether The financial crash and its aftermath ... AND CYCLE - PROOF REGULATION Perhaps a starting point for financial market regulators should be an acceptance that crashes and crises in markets are an inherent part of the system They
Ngày tải lên: 30/10/2014, 16:18
Development of a robotic nanny for children and a case study of emotion recognition in human robotic interaction
... //face -and- emotion.com/dataface/facsaid/description.jsp, 2003. [56] M. Pantic and L.J.M. Rothkrantz. Automatic analysis of facial expressions: The state of the art. IEEE Transactions on Pattern Analysis and Machine ... and they can be mainly classified into two categories: geometrybased and appearance-based Geometry-based methods usually extract facial features such as the shapes and locations of facial ... [46] T. Shibata, T. Mitsui, K. Wada, A. Touda, T. Kumasaka, K. Tagami, and K. Tanie. Mental commit robot and its application to therapy of children. In International Conference on Advanced Intelligent
Ngày tải lên: 09/09/2015, 10:18
Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy
... differentiaiton/lineage markers Parietal endoderm marker Pancreas Pancreas Pancreas Pancreas Pancreas Pancreas other differentiation/lineage marker other differentiation/lineage marker Neural Neural ... Purwanti, Chrishan Julian Alles Ramachandra, Mohammad Shahbazi, Chunxiao Wu, Kai Ye, Ying Zhao, Jieming Zeng and Detu Zhu have been invaluable resources, not only for their technical help, tips and ... Nakagawa M, Koyanagi M, Tanabe K, Takahashi K, Ichisaka T, Aoi T, Okita K, Mochiduki Y, Yamanaka S (2007) Generation of Induced Pluripotent Stem Cells Without Myc From Mouse and Human Fibroblasts
Ngày tải lên: 09/09/2015, 18:56
Characterization and design of CMOS components for microwave and millimeter wave applications
... Integrated Circuits and Systems, vol. 25, pp. 12–18, Jan. 2006. [64] S. Batterywala, R. Ananthakrishna, Y. Luo, and A. Gyure, ? ?A statistical method for fast and accurate capacitance extraction in the ... for the effects In chapters 5 and 6, a systematic study of millimeter wave line resonators and the design of bandpass filters at 60 and 77 GHz in a standard CMOS is demonstrated ... 21] They can realize small and accurate inductances and thus replace lumped... of Publications Journal Papers • L Nan, Y.-Z Xiong, K Mouthaan, A Issaoun, J Shi, and B.-L Ooi, ? ?A Thru-Short
Ngày tải lên: 12/09/2015, 09:42
A semantic approach for scalable and self organized context aware systems
... prototype evaluations 197 vi Summary The advancement of context-aware computing allows users, devices and services to be aware of and automatically adapt to their physical and computational environments ... SELF-ORGANIZED CONTEXT-AWARE SYSTEMS GU TAO NATIONAL UNIVERSITY OF SINGAPORE 2005 A SEMANTIC APPROACH FOR SCALABLE AND SELF-ORGANIZED CONTEXT-AWARE SYSTEMS GU TAO (B.Eng., HUST and M.S., NTU) A THESIS ... recent years, many context-aware systems have been built to meet the required levels of autonomy and flexibility for advanced applications Context information plays a key role in proliferating and
Ngày tải lên: 12/09/2015, 21:26
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, ... enzyme, and contained Aba, Abb and Abcat 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP, dGTP and dTTP. The product was separated from ... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The PCR solution was prepared in the buffer supplied with...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... tsA58T Ag cDNA carry- ing the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotake ... LEC, lymphatic endothelial cell; Lyve-1, lymphatic vessel endothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA, paraformaldehyde;...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf
... Northeastern Area State and Private Forestry, for desktop publishing; and Victoria Evans, Group Leader – Creative Services, Northeastern Area State and Private Forestry, for her oversight and ... based market reports, trade magazines, and trade associations. Developing a relationship with an academic institution that has a wood science program that provides some market information can ... case of small wholesalers and manufacturers, frequently pricing is more of an art than a science. Manufacturing or purchase costs, overhead, general, administrative and selling costs, and a...
Ngày tải lên: 18/02/2014, 22:20
Bạn có muốn tìm thêm với từ khóa: