... oscillations while operating with any gain (the OpAmps which are not stable with unity gain are almost extinct), - tolerance to at least 100 pF of the load capacitance and to a small or nonlinear ... Trang 10OpAmps, and review the basic parameters and characteristics of bipolar and CMOS transistors that are important for successful analog design Chapter 2 outlines the application of signal ... devices are actually used for analog units to avoid leakage, charge tunneling and other problems of the short-channel devices Practically all new processes for analog design are modular, with the capabilities
Ngày tải lên: 20/10/2021, 21:42
... considering that a HEV can save about 40% with respect to actual cars This result has been obtained with commercial PV panels and with realistic data and assumptions on the achievable net solar energy ... reliability of panels in case of lateral impacts) FIG 3 - SIMPLIFIED SCHEME OF SOLAR CAR (LATERAL AND REAR VIEW). The maximum panel area can be estimated as function of car dimensions and shape For ... body and battery (of course, also solar fraction decreases with panel area) Trang 7C Sensitivity analysis A sensitivity analysis has been also carried out, in order to study the effects of design
Ngày tải lên: 30/03/2014, 10:20
DESIGN AND CHARACTERISATION OF a CONTINUOUS ROTARY DAMPER WITH IDEAL VISCOUS DAMPING PROPERTIES
... damper with linear damping properties, it would be necessary to take a look at damping as a whole, as well as commercial viscous dampers that are already available 3.1 Damping Damping is the phenomenon ... at achieving force control, each form of implementation has their advantages and disadvantages Much attention was spent on the SDA as it is the focus of this research An analysis of the SDA system ... actuator to solve the low bandwidth problem of the SEA The macro actuator is a SEA with low output impedance but a low controllable bandwidth The mini actuator is a small, single stage gear transmission
Ngày tải lên: 02/10/2015, 17:14
DESIGN AND CHARACTERISATION OF a CONTINUOUS ROTARY DAMPER WITH IDEAL VISCOUS DAMPING PROPERTIES
... damper with linear damping properties, it would be necessary to take a look at damping as a whole, as well as commercial viscous dampers that are already available 3.1 Damping Damping is the phenomenon ... at achieving force control, each form of implementation has their advantages and disadvantages Much attention was spent on the SDA as it is the focus of this research An analysis of the SDA system ... actuator to solve the low bandwidth problem of the SEA The macro actuator is a SEA with low output impedance but a low controllable bandwidth The mini actuator is a small, single stage gear transmission
Ngày tải lên: 04/10/2015, 10:25
Design and development of a CMOS power amplifier for digital applications
... Class D Power Amplifier A Class D power amplifier uses a pair of transistors as a pair of switches that defines either a rectangular drain voltage or rectangular drain current waveform It also ... envelope signal with peak-to-average ratio A digital modulated signals is also not a simple sinusoidal signal, but consist of a carrier signal (which is a sinusoidal signal) modulated by a modulating ... the metal layers As a result, the inter-poly capacitor is best used as a shunt capacitor to ground where the parasitic capacitance can be lumped to the main capacitance Another alternative is
Ngày tải lên: 04/10/2015, 10:25
Design of two stage operational amplifier using indirect feedback
... with a single dominated pole behavior because these are easily analyzed and can tolerate negative feedback without stability issues As a result, Trang 10single stage operational amplifiers have ... feedback compensation, operational amplifiers with indirect frequency compensation can be designed with higher speed, lower power, and small layout area Two-Stage Operational Amplifier Design and ... the operational amplifier 14 Figure 7 Block diagram of an indirect feedback compensated operational amplifier 15 Figure 8 Schematic of two-stage operational amplifier with indirect feedback
Ngày tải lên: 12/06/2022, 21:45
A regressive approach to the design of continuous capture process with multi-column chromatography for monoclonal antibodies
... capacity, and the mass transfer kinetics dominated by the (intraparticle) pore diffusion Although analyti- cal solutions such as constant pattern approximation (CPA) can be used in batch loading ... study: MabSelect SuRe (MSS) ( dp = 85 μm) from Cytiva (Uppsala, Sweden), KanCapA 3G (KC3) ( dp = 75 μm) from Kaneka (Osaka, Japan) and Amsphere A3 (AA3) ( dp = 50 μm) from JSR (Tokyo, Japan) Prepacked ... D.G Shirazi , A Felinger , A.M Katti , Fundamentals of Preparative and Nonlinear Chromatography, Academic Press, 2006 [18] N Yoshimoto, Y Sugiyama, S Yamamoto, A simple method for calculating
Ngày tải lên: 25/12/2022, 02:48
Design of spring roll factory with a yield of 1500 tons per year
... that of bacteria that exist on fish, including aerobic bacteria, facultative anaerobic bacteria G-bacteria such as Pseudomonas, Alteromonas, Acinetobacter, Moraxella, Flavolacberium, Cytophaga, ... jicama at each stage 32 Table 5 9 The mass and loss of taro at each stage 33 Table 5 10 The mass and the loss of onion at each stage 34 Table 5 11 The mass and the loss of garlic at each stage ... treatment The industrial park uses a specially designed dirty sewer system and a local waste treatment machine with Vietnamese standards and regulations The wastewater treatment system has a
Ngày tải lên: 07/04/2023, 16:20
(Đồ án hcmute) design of spring roll factory with a yield of 1500 tons per year
... that of bacteria that exist on fish, including aerobic bacteria, facultative anaerobic bacteria G-bacteria such as Pseudomonas, Alteromonas, Acinetobacter, Moraxella, Flavolacberium, Cytophaga, ... jicama at each stage 32 Table 5 9 The mass and loss of taro at each stage 33 Table 5 10 The mass and the loss of onion at each stage 34 Table 5 11 The mass and the loss of garlic at each stage ... treatment The industrial park uses a specially designed dirty sewer system and a local waste treatment machine with Vietnamese standards and regulations The wastewater treatment system has a
Ngày tải lên: 09/04/2023, 16:47
(Tiểu luận) design a logo with a slogan about a local destination or tourism
... ofTra Kieu citadel and the My Son temple tower relic area Through manybattles During the war, Champa kingdom was gradually pushed south by DaiViet In 1471, the last capital of Champa at Bau Gia, ... brilliant Sa Huynh culture At migration sites and burial sites such as Hau Xa, Thanh Chiem, An Bang,Xuan Lam, Trang Soi, Dong Na, etc., many types of graves, jars, productiontools, and ornaments ... 3architectural schools: Vietnam, Japan, and China Trang 12Pa dynasty were held. Trang 13Rung dua Bay Mau• Address: Cam Thanh Commune, Hoi An City Seven Mau coconut forest is located about 3 km southeast
Ngày tải lên: 30/01/2024, 05:16
The design of a snack production factory with a capacity of 3000 tons per year
... Health [24] Hazardous Substances Database, National Library of Medicine [25] Yehye, WA; Rahman, NA; Ariffin, A; Abd Hamid, SB; Alhadi, AA; Kadir, FA & Yaeghoobi M (28 August 2015) "Understanding ... industrial parks, we chose the location to build the factory as Amata Industrial Park located on National Highway 1A, Long Binh Ward, Bien Hoa City, Dong Nai Province Amata Industrial Park was created ... country and the region and was established in 1994, after many expansions, the industrial park has an area of 513 hectares The total investment capital in the industrial park has so far reached
Ngày tải lên: 25/02/2024, 15:03
Đồ án tốt nghiệp Công nghệ thực phẩm: Calculation and Design Of A Factory Producing Chocolate With A Capacity Of 2200KG Per day
... features ample space with a level and elevated road layout for efficient drainage Additionally, an extra gate enhances transportation for raw materials, products, and staff, complementing the main ... yields approximately 4 to 5 fruits. Table 1.1: Raw material harvesting chart Material balanceThe formula for calculating the volume of material coming out at each stage: Gnv:The initiala quantity ... mixing machine, heating and softening machine, chocolate packaging machine - Chocolate packaging machine is used for products that are heart-shaped, cube-shaped, hemispherical and have a diameter
Ngày tải lên: 20/12/2024, 11:17
Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling
... Higashimita, Tama-ku, Kawasaki, Kanagawa, 214-8571, Japan ** Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, 562, Nanatsuka, Shobara, Hiroshima 727-0023, Japan ... 2646-2649 Japan Water Works Association (JWWA) (2001) The method of Japan Water Works Association p.573-613 (in Japanese) Kobayashi, F., Hayata, Y., Kohara, K., Muto, N., Miyake, M and Osajima, Y (2006) ... Trang 1Inactivation of microorganisms in untreated water by a Fumiyuki KOBAYASHI*, Futoshi YAZAMA**, Hiromi IKEURA*, Yasuyoshi HAYATA* Norio MUTO** and Yutaka OSAJIMA*** * School of Agriculture,
Ngày tải lên: 05/09/2013, 09:38
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
... Energy and Environment, Rajiv Gandhi Proudyogiki Vishwavidyalaya, Bhopal, India Abstract An experimental investigation has been carried out to examine the Performance parameters and exhaust emission ... is an alternative, renewable, clean diesel fuel made by conversion of the vegetable oils, waste animal fats to esters via transesterification with methanol or ethanol using catalyst The reaction ... agriculture practices One hectare of plantation on average soil will give 1.6 MT oil [21] There are several advantages with Jatropha Firstly, it is easier to harvest than large tree and has much shorter
Ngày tải lên: 05/09/2013, 16:11
Tài liệu User-Centered Design: A Developer''''s Guide to Building User-Friendly Applications ppt
... products are claimed as trademarks Where those designations appear in this book, and O’Reilly Media, Inc., was aware of a trade‐ mark claim, the designations have been printed in caps or initial caps ... Design is a Spotted Nothura (Nothura mac‐ ulosa), a species of bird called a tinamou, which is native to grassy habitats in eastern and southern Brazil, Paraguay, Uruguay, and northern Argentina The ... he’ll just use that Dan believes that the best way to draw and take notes is with pen and paper He thinks drawing with an iPad app lacks agility and feels very unnatural Example Persona www.it-ebooks.info
Ngày tải lên: 21/02/2014, 10:20
Forecasting UK GDP growth, inflation and interest rates under structural change: a comparison of models with time-varying parameters potx
... forecasting In particular, models that incorporate a gradual change in parameters and also include a large set of explanatory variables do particularly well as far as the inflation forecast is concerned ... lead to large and statistically significant gains in forecast accuracy Key words: Time-varying parameters, stochastic volatility, VAR, FAVAR, forecasting, Bayesian estimation JEL classification: ... External MPC Unit Bank of England Email: alina.barnett@bankofengland.co.uk (2) Centre for Central Banking Studies Bank of England Email: haroon.mumtaz@bankofengland.co.uk (3) Monetary Assessment and
Ngày tải lên: 06/03/2014, 14:20
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... Trang 1Annals of Mathematics On the Julia set of a typical quadratic polynomial with a Siegel disk By C L Petersen and S Zakeri Trang 2On the Julia set of a typicalquadratic polynomial with ... is as follows: When a nb n , we say that a n /b nis boundedfrom above by a constant which is asymptotically universal Similarly, when a n b n , we say that a n and b n are comparable up to a ... Beltramidifferentials with unbounded dilatation [Da] David’s integrability condition requires that for all large K, the area of the set of points where the dilatation is greater than K be dominated by an exponentially
Ngày tải lên: 14/03/2014, 22:20
Consultative document A framework for dealing with domestic systemically important banks pptx
... from Argentina, Australia, Belgium, Brazil, Canada, China, France, Germany, Hong Kong SAR, India, Indonesia, Italy, Japan, Korea, Luxembourg, Mexico, the Netherlands, Russia, Saudi Arabia, Singapore, ... the failure of a globally active bank As such this allowed for an assessment of the banks that are systemically important in a global context The unit of analysis was naturally set at the globally ... states that “global systemic importance should be measured in terms of the impact that a failure of a bank can have on the global financial system and wider economy rather than the risk that a
Ngày tải lên: 15/03/2014, 10:20
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf
... Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTTTCAAGTGC Q76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG Reverse CCTCATTTCCTCCGGGAAGACTTTTGAATAC N77G Forward ... bold. Standard All Forward GCTCAGGCGACCATGGGCCATCATCATC Reverse CTTGCATGCCCTGCAGGTCG Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAGGACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT ... recombinant cystatin A variants with Gly replacing each of these amino acids were prepared, and their interaction with papain, cathepsin L, and cathepsin B was characterized by equilibrium and kinetic
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: New members of the brachyurins family in lobster include a trypsin-like enzyme with amino acid substitutions in the substrate-binding pocket potx
... of crayfish (Astacidea) trypsins and a group that includes trypsins from P argus (Palinura), Brachyura, Penaeoidea, Cari-dea and Euphausiacea (Fig 5) Although with low bootstrap values, NJ reconstruc-tion ... Database The nucleotide sequence data for PaTry1a, PaTry1b, PaTry2, PaTry3 and PaTry4 are available in the GenBank database under the accession numbers GU338026, GU338027, GU338028, GU338029 and ... Perera, Center for Marine Research, University of Havana, Calle 16 No 114 e ⁄ 1ra y 3ra, Miramar, Playa, CP 11300 Habana, Cuba Fax: +53 7 2042380 Tel: +53 7 2030617 E-mail: erickpb@comuh.uh.cu Database
Ngày tải lên: 23/03/2014, 03:20