descriptive statistics by cca participation status

Probability and Statistics by Example pptx

Probability and Statistics by Example pptx

... series of texts and problem books, one by S Ross [Ros1–Ros6], another by D Stirzaker [St1–St4], and the third by G Grimmett and D Stirzaker [GriS1–GriS3] The books by Ross and Stirzaker are commonly ... sprinkled some historical information throughout the text Probability and Statistics by Example Volume I Basic Probability and Statistics Y SUHOV University of Cambridge M KELBERT University of Wales–Swansea ... Probability and Statistics by Example: I Probability and statistics are as much about intuition and problem solving, as they are about...

Ngày tải lên: 28/03/2014, 10:20

373 403 0
báo cáo hóa học:" Changes in the SF-8 scores among healthy non-smoking school teachers after the enforcement of a smoke-free school policy: a comparison by passive smoke status" doc

báo cáo hóa học:" Changes in the SF-8 scores among healthy non-smoking school teachers after the enforcement of a smoke-free school policy: a comparison by passive smoke status" doc

... lower mental component score by 1.7 on the SF-8 than the Japanese National Norm [22], and that university students having any allergic disorders showed lower domain scores by 2.3 on the SF-8 than ... health status questionnaire (Japanese version) Arerugi 2006, 55(10):1288-1294 23 Takeuchi N, Ito M, Ogino S: Assessment of quality of life in university students with the SF-8 health status questionnaire ... non-smoking school teachers after the enforcement of a smoke-free school policy: a comparison by passive smoke status Health and Quality of Life Outcomes 2010, 8:44 Page of ...

Ngày tải lên: 20/06/2014, 16:20

8 353 0
On some multivariate descriptive statistics based on multivariate signs and ranks

On some multivariate descriptive statistics based on multivariate signs and ranks

... MULTIVARIATE DESCRIPTIVE STATISTICS BASED ON MULTIVARIATE SIGNS AND RANKS NELUKA DEVPURA (B.Sc. (Statistics) University of Colombo) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF STATISTICS ... situations Finally, we illustrate these descriptive measures by applying them to some simulated and real data sets 1 Chapter Introduction Multivariate descriptive measures have received considerable ... popular in constructing useful descriptive statistics like the median, interquartile range, and various measures of skewness and kurtosis and many other notions of descriptive measures are based...

Ngày tải lên: 27/11/2015, 11:26

156 277 0
Statistics in geophysics descriptive statistics II

Statistics in geophysics descriptive statistics II

... ranked, data values from a particular sample are called the order statistics of that sample Given x1 , x2 , , xn the order statistics x(1) , x(2) , , x(n) for this sample are the same numbers, ... paired data 25 20 15 Miles Per Gallon 30 Boxplots for variables by group 10 ● Number of Cylinders Figure: Boxplot of miles per gallon by car cylinder for car mileage data (n = 32) Winter Term 2013/14 ... given The k (k ≤ n) different characteristics of X are denoted by a1 , , ak The m (m ≤ n) different characteristics of Y are denoted by b1 , , bm a1 a2 ak b1 n11 n21 bm n1m n2m n1 n2...

Ngày tải lên: 04/12/2015, 17:07

29 197 0
Statistics in geophysics descriptive statistics

Statistics in geophysics descriptive statistics

... goal is to extract insights about the processes underlying the generation of the numbers Descriptive statistics is the discipline of quantitatively describing the main features of a collection ... counted The histogram consists of a series of rectangles whose widths are defined by the class limits implied by the bin width, and whose height depend on the number of values in each bin Usually ... analysis of the sample allows us to draw conclusions about the population of interest (inferential statistics) Winter Term 2013/14 5/32 Setting the scene Frequency distributions Population and sample...

Ngày tải lên: 04/12/2015, 17:07

32 262 0
Present Status and Feature of Groundwater Contamination by Nitrate-nitrogen in Kumamoto City

Present Status and Feature of Groundwater Contamination by Nitrate-nitrogen in Kumamoto City

... characterized by the water quality of groundwater - 22 - Journal of Water and Environment Technology, Vol 7, No 1, 2009 RESULTS AND DISCUSSION Overall situation of groundwater contamination by NO3-N ... NO3-N is removed by biological denitrification under anaerobic condition (reductive atmosphere) during the water permeate through the soil This hypothesis will be supported by the situation of ... 2006 The depth and purpose of the wells are summarized in Table The regional groups characterized by water quality are almost depending on their location and groundwater flow The distinctive water...

Ngày tải lên: 05/09/2013, 09:38

10 499 0
A study on increasing students’ participation in communicative activities in large classes by using group work and questioning technique at marie curie high school, hai phong

A study on increasing students’ participation in communicative activities in large classes by using group work and questioning technique at marie curie high school, hai phong

... students’ participation in this class III Comparison of students’ participation before and at the end of the experiment 33 As for quantitative analysis, students’ participation is measured by the ... activities I.3.4 Factors affecting students’ participation From the description of students’ participation in the previous section, we can see that students’ participation depends on different interactions ... students’ participation, in the following sections, we will analyze the data collected in our school and discuss the followings: 1) Students’ participation before the experiment; 2) Students’ participation...

Ngày tải lên: 05/02/2014, 22:02

42 621 2
Tài liệu Smear microscopy and culture conversion rates among smear positive pulmonary tuberculosis patients by HIV status in Dar es Salaam, Tanzania ppt

Tài liệu Smear microscopy and culture conversion rates among smear positive pulmonary tuberculosis patients by HIV status in Dar es Salaam, Tanzania ppt

... were Page of given standard short course treatment of tuberculosis regardless of their HIV status HIV status of the subjects was identified through the routine National Tuberculosis and Leprosy ... culture were followed up again at the 8th week with the same testing as by the end of week Those who were still positive by microscopy and/or culture were then followed up again at the 12th week, ... (Epi Data version 3.1) followed by data cleaning The data was transferred to SPSS version 15 for analysis For categorical variables, Pearson Chi-squares and Wald statistics were used, and Student’s...

Ngày tải lên: 15/02/2014, 12:20

6 445 0
Forest Economic and Environmental Accounting: A pilot study of a first implementation by Statistics Sweden docx

Forest Economic and Environmental Accounting: A pilot study of a first implementation by Statistics Sweden docx

... forest inventory 2.3 Industry production statistics 2.4 Industry input goods statistics 2.5 Foreign trade statistics 2.6 Energy statistics 2.7 Waste statistics, recycled material Valuation of ... in two ways By the NFI fellings are measured by a stump enumeration, the yearly estimates have a standard error of %, by the NFI you get information about spices and felling methods By The National ... out by the division of National accounts and the division of Environmental statistics (spec environmental accounts) Data on forest resources (forest balances, area and volume) are compiled by...

Ngày tải lên: 08/03/2014, 08:20

48 521 0
Cancer Clinical Trials: Participation by Underrepresented Populations doc

Cancer Clinical Trials: Participation by Underrepresented Populations doc

... commonly reported barrier to trial participation. 8, 34-38 For example, in a study of African American/black cancer patients, only 8.3% were eligible for clinical trial participation due to strict eligibility ... Nguyen TT, Somkin CP Ma Y Participation of Asian-American women in cancer , chemoprevention research: physician perspectives Cancer 2005 104(12 Suppl):3006-14 28 Killien M, Bigby JA, Champion V, et ... 22(4):730-734 35 Kemeny MM, Peterson BL, Kornblith AB, et al Barriers to clinical trial participation by older women with breast cancer J Clin Oncol 2003 21:2268-2275 , 36 Gross CP Herrin J,...

Ngày tải lên: 22/03/2014, 17:20

4 115 0
báo cáo sinh học:" Tracking working status of HIV/AIDS-trained service providers by means of a training information monitoring system in Ethiopia" pdf

báo cáo sinh học:" Tracking working status of HIV/AIDS-trained service providers by means of a training information monitoring system in Ethiopia" pdf

... as replacements The data were analysed by means of SAS software Summary statistics were generated with gender, type of provider, type of facility, working status and reasons for leaving as the ... was performed to analyse comparisons by variables potentially related to attrition For the chi-square analysis, attrition was further grouped by HIV-working status into "working in HIV" and "not ... analysis were similar The HIV-working status was used because it more accurately reflects the concept being discussed Working status was analysed based on work location by grouping regions into established...

Ngày tải lên: 18/06/2014, 17:20

8 367 0
báo cáo hóa học: " Participation of MCP-induced protein 1 in lipopolysaccharide preconditioning-induced ischemic stroke tolerance by regulating the expression of proinflammatory cytokines" pdf

báo cáo hóa học: " Participation of MCP-induced protein 1 in lipopolysaccharide preconditioning-induced ischemic stroke tolerance by regulating the expression of proinflammatory cytokines" pdf

... 5’GGCAGTGGTTTCTTACGAAGGA, TNFα: F: 5’- CTGAGGTCAATCTGCCCAAGTAC; R: 5’-CTTCACAGAGCAATGACTCCAAAG, IL-1β: F: 5’- GCCCATCCTCTGTGACTCAT; R: 5’- AGGCCACAGGTATTTTGTCG, IL-6: F: 5’- TCGTGGAAATGAGAAAAGAGTTG; ... R: 5’- AGTGCATCATCGTTGTTCATACA, MCP-1: F: 5’- CCATCTCTGACCTGCTCTTCCT; R: - AGACCCACTCATTTGCAGCAT, β-actin: F: 5’- AAATCGTGCGTGACATCAAAGA; R: 5’- GGCCATCTCCTGCTCGAA Western Blot Western blot was ... treated by mice tail-vein injection 1h before ischemia at a dose of 15 mg/kg Statistical Analysis The data are presented as mean ± SD Multiple comparisons were evaluated by one-way ANOVA followed by...

Ngày tải lên: 19/06/2014, 22:20

38 423 0
báo cáo hóa học:" Challenges faced by health workers in providing counselling services to HIV-positive children in Uganda: a descriptive study" potx

báo cáo hóa học:" Challenges faced by health workers in providing counselling services to HIV-positive children in Uganda: a descriptive study" potx

... parenthood and lack of consistency by caretakers also emerged as major challenges: This explanation by the health worker shows that the fears of children are compounded by their own experiences of seeing ... treatment and when he was taken back to school (Health worker, Nsambya) Caretaker-related challenges Health workers are also constrained by the unwillingness of child caretakers to disclose the condition ... worker, Buhinga Hospital) Direct (biological) parents fear to disclose HIV status to their children for fear to be blamed by their children (Health worker, AIC) Some of the children have watched...

Ngày tải lên: 20/06/2014, 08:20

9 406 0
Báo cáo khoa học nông nghiệp " Nutrient recovery by rice crops as a treatment for aquaculture solid waste: crop yield, nutrient status and nutrient budgets " doc

Báo cáo khoa học nông nghiệp " Nutrient recovery by rice crops as a treatment for aquaculture solid waste: crop yield, nutrient status and nutrient budgets " doc

... practice by farmers Threshing was carried in the rice fields leaving rice straw in situ Under triple rice pattern, straw is usually spread evenly and then burned to facilitate land preparation by rotary ... treatments were positive This confirmed that rational use of rice straw either by retention in paddy fields or by making compost or mixing with fishpond solid waste can help farmers save money ... components were measured on samples collected in two quadrats of 0.5x 0.5 m Actual yields were recorded by harvesting m2 in every plot Rough rice was then dried, weighed and measured for moisture content...

Ngày tải lên: 21/06/2014, 04:20

24 348 0
Báo cáo hóa học: " The Optimal Design of Weighted Order Statistics Filters by Using Support Vector Machines" doc

Báo cáo hóa học: " The Optimal Design of Weighted Order Statistics Filters by Using Support Vector Machines" doc

... problem is nonseparable by a hyperplane in input space, but it can be separated in the feature space defined by the polynomial kernel, p K x, xi = xT xi + (12) When xi is replaced by its mapping in ... product of the two vectors induced in the feature space can be replaced by the inner-product kernel denoted by K(x, xi ) and defined by K x, xi = ϕ(x) · ϕ xi (54) Once a kernel K(x, xi ) which satisfies ... Original “Lenna” image; (b) “Lenna” image corrupted by 5% impulse noise; (c) “Lenna” image corrupted by 10% impulse noise; (d) “Lenna” image corrupted by 15% impulse noise the window of width be Xi...

Ngày tải lên: 22/06/2014, 23:20

13 294 0
Báo cáo lâm nghiệp: " Predator/prey ratios: a measure of bark-beetle population status influenced by stand composition in different French stands after the 1999 storms" pps

Báo cáo lâm nghiệp: " Predator/prey ratios: a measure of bark-beetle population status influenced by stand composition in different French stands after the 1999 storms" pps

... ith type (relative areas covered by each species) As the number of tree species increases, this index produces values ranging from (when the landscape is composed by only one tree species) to infinity ... (spruce) concentration In this case, the scarcity of bark beetles would have been driven by host availability and not by predation However, unattacked spruces still remain in both stands and, in one ... half-filled with car antifreeze (ethylene-glycol) as a preservant The traps were distant from each other by 1520 m along a winding course in the stand They were inspected seven or eight times each year...

Ngày tải lên: 08/08/2014, 00:22

8 366 0
w