descargar with a little help from my friends the beatles mp3

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

... proteases of the coagulation system including thrombin (factor IIa) and factors IXa, Xa, XIa and XIIa. The princi- pal targets of the serpin are usually regarded as being thrombin and factor Xa, although ... immediate and medium term future. Acknowledgements This work was supported by the National Health & Medical Research Council of Australia, the Austra- lian Research Council, the National Heart ... thrombin anion-binding exosite-1 is a primary part of the allosteric activation mechanism. For many years, the physiological activator of HC-II has been assumed to be extravascular dermatan sulfate [56–64],...

Ngày tải lên: 20/02/2014, 02:21

10 670 0
With a Little Help pptx

With a Little Help pptx

... lit by candles and draped with gathered curtains that turned the walls into the proscenia of a grand and ancient stage. There were four or five small tables and a long one at the back of the room, ... the neat stitching that ran the bind- ing and the spine, holding together the nylon and the denim, taken from a pair of jeans, a backpack. The end-papers were yellowed page three girls from the ... he'd joined the Order, and she wasn't there anymore. Her numbers all rang dead. The apartment building had once been a pleasant, middle-class sort of place, with a red awning and a niche...

Ngày tải lên: 06/03/2014, 14:20

282 495 0
Tài liệu Gynecological cancer patients’ differentiated use of help from a nurse navigator: a qualitative study ppt

Tài liệu Gynecological cancer patients’ differentiated use of help from a nurse navigator: a qualitative study ppt

... the NN – they had another better help before the NN contacted them. The NN took the primary contact to the female patients and offered help in the early part of a cancer trajectory. The NN was ... what kind of add- itional help the patients should have. Navigators in cancer care have been proposed to embrace this extra help. They help the cancer patient “not only travel the healthcare maze ... I have heard nothing. I find that scary. (At discharge) Doctors . come and go as they see fit . they come and say their bit and then they leave again (ye s) they can go as far as to turn their...

Ngày tải lên: 13/02/2014, 06:20

11 705 0
Tài liệu The King''''s Post Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and connected with the Ancient City of Bristol from 1580 to the present time pdf

Tài liệu The King''''s Post Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and connected with the Ancient City of Bristol from 1580 to the present time pdf

... PALMER AT THE AGE OF 75. CHAPTER V. [Pg 45] APPRECIATIONS OF RALPH ALLEN, JOHN PALMER, AND SIR FRANCIS FREELING, MAIL AND COACH ADMINISTRATORS. On the 25th April, 1901, the day after a ... Street. The Gloucester and Aberystwith mail-coach continued to run until the year 1854, and it is believed that was the last regular main road mail-coach which was kept on the road. Its guard from ... lamented far beyond the circle of her own family, extensive as it is. The amiableness of her manner and the rational giving such an accommodation to the city of Bath as he always hoped that plan...

Ngày tải lên: 17/02/2014, 02:20

158 678 0
Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc

Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc

... oxidase from Paracoccus denitrificans. Nature 376, 660–669. 8. Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R. & Yoshikawa, ... sealed with another CaF 2 plate, and placed into a metallic sample holder. The following cuvette handling was carried out in the aerobic atmosphere. The absorbance spectra of the mixture before and ... proton-translocating channels, called the K- and D-channels. The D-channel contains an array of charged or polar amino acids, and is located within two different hydrogen-bonded networks above and...

Ngày tải lên: 21/02/2014, 15:20

8 474 0
Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt

Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt

... 489–495. 4 Kinoshita S, Terada T, Taniguchi T, Takene Y, Masu- da S, Matsunaga N & Okada H (1981) Purification and characterization of 6-aminohexanoic acid oligomer hydrolase of Flavobacterium sp. ... S & Higuchi Y (2005) Crystallization and x-ray diffrac- tion analysis of 6-aminohexanoate-dimer hydrolase from Arthrobacter sp. KI72. Acta Crystallogr F61, 928–930. 15 Hatanaka HS, Fujiyama ... potentially possesses an advantage for biotechnological applications. X-ray crystallographic analyses of the G181D ⁄ H266N ⁄ D370Y enzyme and the inactive S11 2A- mutant–Ald complex revealed that Ald...

Ngày tải lên: 07/03/2014, 00:20

10 626 0
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

... CAGGCTCGTGGTGCTAAATGCCCGAACTGCCTGTGCTGTG 3f GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG 4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAG GGAT 1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC 2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r ... CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA Reverse GCTA GGATCCCTAGCAACCACGGCAC Table 2. Antifungal activity of WAMP- 1a. IC 50 is the concentration necessary for 50% growth inhibition. Fungi ... Escherichia coli and assays of recombinant WAMP- 1a activity against diverse plant pathogens, such as chitin-containing and chitin-free fungi, and Gram- positive and Gram-negative bacteria. The amino acid sequence...

Ngày tải lên: 07/03/2014, 02:20

10 507 0
Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx

Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx

... DNA lesions depends on the capacity of the cell to repair the damage before it can be incorporated permanently into the genome. Typically, DNA damage is repaired at a relative high rate in human ... survival) after irradiation. The in vivo biological activity was assayed by the ability to prevent UV induced erythema of human skin. After informed consent and approval from the Ethical Committee ... cyanobacteria, corals and other marine organisms are much more advanced than those of mammals because photosynthetic organisms depend on solar irradiation as their primary source of energy, and at the same time...

Ngày tải lên: 07/03/2014, 15:20

5 451 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

... collec- tion and refinement are summarized in Table 1. The program procheck [34] was used to analyse conforma- tional variations from the defined norms, with the quality of the Ramachandran plots [35] ... To accommodate K100 as a ligand a number of main-chain atoms are displaced relative to their positions in the wt structure. Although backbone deviations are detected at the start of the ligand ... the rearrangement of the ‘open’ and ‘closed’ forms of the ligand loop [19]. Therefore, con- former A may be considered as the open form, albeit with the axial ligand still intact, with the main-...

Ngày tải lên: 07/03/2014, 17:20

15 513 0
Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx

Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx

... in the databases. The two proteins migrating at  50 and  55 kDa (bands A and B; Fig. 1A) were identified from their N-terminal sequences as similar to a- amylase (accession no. AAA17751) from ... and analysed by SDS/PAGE. Carboxypeptidase assays and expression of HaCA42 mRNA Carboxypeptidase assays using the synthetic substrates furylacryloyl-Phe-Phe (FAPP), furylacryloyl-Ala-Lys (FAAK) ... enzyme was analysed by SDS/PAGE (data not shown). By analogy with the activation of mammalian carboxypeptidases, these polypeptides correspond to the active HaCa42 carboxy- peptidase (36 kDa polypeptide)...

Ngày tải lên: 23/03/2014, 12:20

12 458 0
Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc

Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc

... of all the b Na-ScTxs from all the a Na-ScTxs. The a Na-ScTxs have identities of the order of 50% among themselves, the same being true for all the b Na-ScTxs (data not shown). However, when the ... constraints were added to the calculations. The dynamic annealing struc- ture calculations were performed with the CNS software suite [44]. Analysis of Na + -channel sequences By searching data banks ... than the cardiac isoform rNa V 1.5 [67]). However, when the overall charge of both the toxins and the channels are considered together, a plausible explanation comes from analysis of the other region involved...

Ngày tải lên: 23/03/2014, 12:20

13 435 0
Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot

Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot

... GWMSKIASGIGTFLSGMQQa DRS B1 AMWKDVLKKIGTVALHAGKAALGAVADTISQa DRS B2 GLWSKIKEVGKEAAKAAAKAAGKAALGAVSEAVa DRS B3 ALWKNMLKGIGKLAGQAALGAVKTLVGAE DRS B4 ALWKDILKNVGKAAGKAVLNTVTDMVNQa DRS B6 ALWKDILKNAGKAALNEINQLVNQa PBN2 ... 5Â-AGCATAACTGGAACGTGGG-3Â for caerin 1.12, 5Â-CAGCAATAAGTGGAACAACG-3Â for caerin 1.13, 5Â-GTGTTTAGCAACGGATTTACC-3Â for caerin 1.14 and 5Â-AGCAACGGATCCTAGGA CAC-3Â for caerin 1.15. The temperature ... isolated India between 150 and 65 Ma and colonized the Laurasian land mass after India collided with Asia. Abbreviations; AF, Africa; IND, India; AUS, Australia; SA, South America; ANT, Antartica....

Ngày tải lên: 23/03/2014, 17:21

14 308 0
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

... human fibrosarcoma and MCF 7 from human breast adenocarci- noma, were obtained from the Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia, Brescia, Italy. Lipids. A series of natural and ... LUVs. Similar aggregates appeared only very faintly in the absence of lipids (Fig. 4A) . The rather long lag phase preceding fast hemolysis (Fig. 1A) may also indicate that the formation of a functional ... by the mushroom Agrocybe aegerita [3,4]. Moreover, 13 of the ESTs, if translated, are identical with a 138-amino-acid protein (PriA) translated from P. ostreatus cDNA (EMBL/GenBank/DDBJ databases:...

Ngày tải lên: 23/03/2014, 21:20

12 493 0
w