deciding whether a reverse mortgage is right for you

Choosing a treatment that,s right for you

Choosing a treatment that,s right for you

... Sheets • Vascular Access for Hemodialysis • Hemodialysis Dose and Adequacy • Peritoneal Dialysis Dose and Adequacy • Amyloidosis and Kidney Disease • Anemia in Kidney Disease and Dialysis • Renal Osteodystrophy ... refuse treatment You may state that you want your health care team to use all available means to sustain your life Or you may direct that you be withdrawn from dialysis if you become permanently ... has advantages and disadvantages You may also choose to forgo treatment By learning about your choices, you can work with your doctor to decide what’s best for you No matter which treatment you...

Ngày tải lên: 01/09/2012, 11:09

35 1,3K 1
Báo cáo sinh học: " Virology on the Internet: the time is right for a new journal" docx

Báo cáo sinh học: " Virology on the Internet: the time is right for a new journal" docx

... be able to read the same material as wealthier ones (although creating access to the Internet is another matter [10]) This is particularly relevant in virology as many viruses have regional, rather ... declare that my institution holds or has applied for several United Stated and International patents based on technology developed in my laboratory These patents or patent applications cover a range ... reviewers have provided their feedback, the monitoring editor makes the final recommendation Managing Editor, David Sander will be available to assist authors with content and formatting issues not...

Ngày tải lên: 18/06/2014, 22:20

3 315 0
Is Weight Loss Surgery Right for You? potx

Is Weight Loss Surgery Right for You? potx

... (noninsulin-dependent diabetes), increased body fat and abdominal fat, insulin resistance, and ethnicity (with greater risk in African American, Hispanic, and Native American adults) Heart disease, vision problems, ... through and evaluate problems in a more adult manner with each passing year It appears that this process is one that continues well into the early twenties; what this means is that your analytical and ... certain changes in your personality or personal life that you have been hoping for For these, you have to work on aspects of yourself that go beyond your physical appearance and your weight Again,...

Ngày tải lên: 15/03/2014, 04:20

115 449 0
10 steps in developing a strategic social media plan for your business

10 steps in developing a strategic social media plan for your business

... of social media at solving that problem Choose a metric that’s indicative of that goal’s progress and is easy to measure Social media evolves rapidly so your tactics may have to change later T ... ones that are easiest to track Capture multiple analytics as some metrics may later become a better KPI af ter you have had the experience of measuring and analysing the data Roll out st rat egy ... related sectors or specif ic examples that relate to your goal/s Search globally f or the very best case studies and understand how this inf ormation might apply to your organisation and your...

Ngày tải lên: 07/01/2014, 15:27

6 834 0
The Goal Setting ReportA 6-Step Plan to Achieving Your GoalsBy Paul Smithson Smashwords Edition Copyright 2013 Paul Smithson ###Smashwords Edition, License NotesThis ebook is licensed for your personal enjoyment only. This ebook may not be re-sold or pot

The Goal Setting ReportA 6-Step Plan to Achieving Your GoalsBy Paul Smithson Smashwords Edition Copyright 2013 Paul Smithson ###Smashwords Edition, License NotesThis ebook is licensed for your personal enjoyment only. This ebook may not be re-sold or pot

... laser-focused on five goals at a time and achieve each of those goals, than to have so many goals that your overall focus is diminished Step - Goal Analysis Form The Goal Analysis Form will take ... usually find that one category of goals usually dominates the list at any particular time, it is always healthy to have at least one goal in each of the main areas as otherwise it is easy to become ... the page Aim to write at least five realities, and preferably as many as ten Options Now that you have a clear idea of the current reality start to make a list of as many options as you can think...

Ngày tải lên: 18/03/2014, 03:20

34 359 0
248. Getting Into a Top College Gets Harder For Young Americans ppsx

248. Getting Into a Top College Gets Harder For Young Americans ppsx

... This VOA Special English Education Report was written by Nancy Steinbach Read and listen to our reports at voaspecialenglish.com And if you are a teacher and you teach with Special English, ... Special English, please let us know Tell us how you use Special English in the classroom, and for what ages and subjects And please tell us what country you are in Write to special@voanews.com I’m...

Ngày tải lên: 14/08/2014, 21:21

2 145 0
Getting content curation right for your SEO

Getting content curation right for your SEO

... collecting, organizing and displaying information relevant to a particular topic or area of interest.” #contentcuration AT #smxmuenchen by @aleyda from @woorank WHICH ARE THE TYPES OF CONTENT CURATION ... ELEVATION AGGREGATION DISTILLATION MASHUP #contentcuration AT #smxmuenchen by @aleyda from @woorank WHICH ARE THE TYPES OF CONTENT CURATION CHRONOLOGY ELEVATION AGGREGATION DISTILLATION MASHUP ... those about your relevant topics #contentcuration AT #smxmuenchen by @aleyda from @woorank NOW YOU KNOW WHAT YOUR AUDIENCE WANTS #contentcuration AT #smxmuenchen by @aleyda from @woorank and it’s...

Ngày tải lên: 30/11/2015, 21:10

79 133 0
Guidance for Determining Whether a Poultry Slaughter or Processing Operation is Exempt from Inspection Requirements of the Poultry Products Inspection Act docx

Guidance for Determining Whether a Poultry Slaughter or Processing Operation is Exempt from Inspection Requirements of the Poultry Products Inspection Act docx

... Columbia, Maryland, Virginia, and West Virginia Illinois, Ohio, and Indiana Texas Alaska, American Samoa, Arizona, Colorado, Guam, Hawaii, Idaho, New Mexico, Nevada, Northern Mariana Islands, ... Missouri Madison, WI Minneapolis, MN Philadelphia, PA Raleigh, NC Springdale, AR 26 Michigan and Wisconsin Minnesota, Montana, North Dakota, South Dakota, and Wyoming Pennsylvania and New Jersey ... Jersey North Carolina, South Carolina, and Kentucky Arkansas, Louisiana, and Oklahoma Attachment OPEER Regional Offices Contact Information http://www.fsis.usda.gov/Contact_Us/Office_Locations_&_Phone_Numbers/index.asp#opeer...

Ngày tải lên: 23/03/2014, 21:20

36 869 0
Tài liệu Báo cáo khoa học: A DExD⁄ H box RNA helicase is important for K+ deprivation responses and tolerance in Arabidopsis thaliana docx

Tài liệu Báo cáo khoa học: A DExD⁄ H box RNA helicase is important for K+ deprivation responses and tolerance in Arabidopsis thaliana docx

... (Invitrogen, Carlsbad, CA, USA) Quantitative real-time PCR analysis Total RNA was extracted with Trizol reagent from different tissues of Arabidopsis Contaminated DNA was removed with RNase-free DNase ... 451–458 Anderson JA, Huprikar SS, Kochian LV, Lucas WJ & Gaber RF (1992) Functional expression of a probable Arabidopsis thaliana potassium channel in Saccharomyces cerevisiae Proc Natl Acad Sci USA ... homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana Curr Biol 12, 1484–1495 26 Inagaki S, Suzuki T, Ohto MA, Urawa H, Horiuchi T, Nakamura K & Morikami A (2006) Arabidopsis...

Ngày tải lên: 14/02/2014, 18:20

11 787 0
Tài liệu GIVING CREDIT WHERE CREDIT IS DUE: CREATING A COMPETENCY-BASED QUALIFICATIONS FRAMEWORK FOR POSTSECONDARY EDUCATION AND TRAINING pdf

Tài liệu GIVING CREDIT WHERE CREDIT IS DUE: CREATING A COMPETENCY-BASED QUALIFICATIONS FRAMEWORK FOR POSTSECONDARY EDUCATION AND TRAINING pdf

... within a standard The standard associated with certifications is an American National Standard and an ISO/IEC Standard 17024 It addresses the requirements of a certification program that looks at ... private sector and states set industry standards For example, ANSI, a membership-based organization, develops the American National Standards Although ANSI is a quasigovernmental organization, ... Council for Adult and Experiential Learning (CAEL) has established and disseminated standards for awarding credit through prior learning assessment It has also trained faculty evaluators and conducted...

Ngày tải lên: 16/02/2014, 03:20

46 480 0
Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx

Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx

... Table Chorismate synthase activity of the serine mutant proteins (Ser16Ala, Ser127Ala and Ser16AlaSer127Ala) in comparison with the activity of the wild-type enzyme The formation of chorismate ... exchanged are in bold): S1 6A, forward primer, 5¢-CGACCTATGGCGAGGCGCACTGCAAGTCG3¢, and reverse primer, 5¢-CGACTTGCAGTGCGCCTCGC CATAGGTCG-3¢; S12 7A, forward primer, 5¢-GCGGCCG CTCTGCCGCCCGCGAGACC-3¢, ... 7.5, and enzyme (1.25 lm for the wild-type and Ser127Ala mutant proteins or 12.5 lm of the Ser16Ala and Ser16AlaSer127Ala mutant proteins) Chorismate formation was monitored at 275 nm under anaerobic...

Ngày tải lên: 07/03/2014, 05:20

10 401 0
Báo cáo khoa học: A mammalian monothiol glutaredoxin, Grx3, is critical for cell cycle progression during embryogenesis doc

Báo cáo khoa học: A mammalian monothiol glutaredoxin, Grx3, is critical for cell cycle progression during embryogenesis doc

... the we used the forward primer 5¢-GCCGGATCCATGACTGTG GTTGAAATAAAAAG-3¢ and the reverse primer 5¢-CCGG AGCTCTTACTGTAGAGCATGTTGGAAATA-3¢ Fulllength cDNA of HsGrx3 and MmGrx3 were amplified by PCR ... specifically targeting human Grx3 sequences were purchased from SigmaAldrich The human Grx3 shRNA1 sequence is 5¢-CCG GGCTCTTTATGAAAGGAAACAACTCGAGTTGTTTC CTTTCATAAAGAGCTTTTTG-3¢ The human Grx3 shRNA2 ... 5¢-CATGGTGCCCAGAAATGAAC-3¢; probe (Grx3-79T): 5¢-CTACTGCGCCTCAAAACCAAGTCACT CCT-3¢ The housekeeping gene cyclophilin was used to normalize the gene expression data Mammalian monothiol glutaredoxin...

Ngày tải lên: 14/03/2014, 23:20

15 314 0
Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc

Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc

... activate it Active RPTPa-D2 is required for Src activation Materials and methods Materials and antibodies Anti-HA-tag (12CA5), anti-Src (327) Igs and anti-RPTPa (5478AP) serum were prepared as ... distinctive form of Noonan syndrome Nat Genet 39, 75–79 37 Razzaque MA, Nishizawa T, Komoike Y, Yagi H, Furutani M, Amo R, Kamisago M, Momma K, Katayama H, Nakagawa M et al (2007) Germline gain-of-function ... forward and reverse oligonucleotides: 5¢- ATG AAG AAG AAC CAT GTT TTA CAG ATC -3¢ and 5¢ - GAT CTG TAA AAC ATG GTT CTT CTT CAT - 3¢ The constructs encoding WT, R554H or C723S GST-PTPalpha D2...

Ngày tải lên: 15/03/2014, 10:20

9 291 0
w