d mri using a cellular model and homotopic deformations

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

... 2D- PAGE database dehydrogenase and to mitochondrial ATP synthase a subunit by comparison with 2D electrophoresis (2-DE) maps available in the SWISS 2D- PAGE database (http://www.expasy.org) Additionally, ... of a PD model Fig A representative silver-stained 2-DE gel of proteins extracted from b-gal cells treated with catalase (cat) Qualitative differences are indicated by squares (A: ATP synthase a; ... with a Universal Microplate reader Model 550 (Bio-Rad, Hercules, CA, USA) All experiments were run in triplicate 2-DE electrophoresis and statistical analysis a- Syn and b-gal cells treated or...

Ngày tải lên: 15/02/2014, 01:20

11 787 0
Báo cáo khoa học: "A Part of Speech Estimation Method for Japanese Unknown Words using a Statistical Model of Morphology and Context" pptx

Báo cáo khoa học: "A Part of Speech Estimation Method for Japanese Unknown Words using a Statistical Model of Morphology and Context" pptx

... sequence kanji katakana katakana-kanji kanji-hiragana hiragana kanji-katakana kat akana-symbol-katakana number kanji-hiragana-kanji alphabet kanji-hir agana-kanji-hir agana hiragana-kanji percent ... present a statistical model of Japanese unknown words using word morphology and word context We find that Japanese words are better modeled by classifying words based on the character sets (kanji, ... < a l p h a > , < h i r a > , < k a t a > , and < k a n > represent a sequence of symbols, numbers, alphabets, hiraganas, katakanas, and kanjis, respectively < k a n - h i r a > and < h i r a...

Ngày tải lên: 23/03/2014, 19:20

8 399 0
Human embryonic stem cells as a cellular model for osteogenesis in implant testing and drug discovery

Human embryonic stem cells as a cellular model for osteogenesis in implant testing and drug discovery

... collected and washed with PBS for three times again Total mRNA was extracted from collected H9 cells, days EB and days EB colonies using RNeasy Kit (QIAGEN, Chatsworth, CA, USA) cDNA was synthesized ... OCT4 F: CGRGAAGCTGGAGGAGAAGGAGAAGCTG 55 oC R: AAGGGCCGCAGCTTACACATGTTC NANOG F: GGCAAACAACCCACTTCTGC 55 oC R: TGTTCCAGGCCTGATTGTTC β-ACTIN F: ACAGAGCCTCGCCTTTGCC 58 oC R: ACATGCCGGAGCCGTTGTC 2.1.5 ... ISO 10993 standards DMSO was used as control MTS assay is a standard laboratory colorimetric assay that measures the activity of mitochondrial activity Enzyme reductase from mitochondria converts...

Ngày tải lên: 16/10/2015, 15:38

117 392 0
Asset Allocation in Active Portfolio Management using Treynor-Black Model and Technical Trends

Asset Allocation in Active Portfolio Management using Treynor-Black Model and Technical Trends

... than 1000 data points The data points were derived from Yahoo! Finance The data points were used to obtain abnormal returns (alpha), beta and residual variance of each of the above mentioned ... for date range were not entirely accurate The method to calculate the days, DaysCalculator(Date, Date), does not consider the fact that the index does not work on - 29 - weekends and bank holidays ... file and close - 37 - Appendix – User guide Download and save the data files as mentioned in Appendix Launch the software package Select FTSE from the symbol list, select the date range and then...

Ngày tải lên: 29/04/2013, 14:07

40 501 0
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx

Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx

... experiment During and immediately following the melt, additional quantities of acetone, carbon dioxide, and other volatiles evolved, which indicates thermal degradation Thermal degradation after the ... melt and creates an uncertain baseline Second, the varying quantities of water in the starting material (Form I) result Table Summary of DSC data, suggested results, and additional characterizations ... anhydrous Form I and anhydrous Form II Hygroscopicity studies performed at 52% and 100% relative humidity (RH) indicated that Form I formed a heptahydrate at typical laboratory temperatures and...

Ngày tải lên: 14/02/2014, 03:20

16 553 0
Báo cáo khoa học: "A NATUWAL LANGUAGE INTERFACE USING A WORLD MODEL" pdf

Báo cáo khoa học: "A NATUWAL LANGUAGE INTERFACE USING A WORLD MODEL" pdf

... candidate word graph semantically checks and interprets the relationships, based on the world model 'Bunsetsu' sequences of a Japanese-language sentence are relatively arbitrary And conversational ... using a $class facet and mapping information to the database schema using a Sstorage facet The value of a Sstorage facet denotes the class name which has mapping information The sales class has ... part of the world model for a sales domain The commodity class has two attribute classes, commodity's name and fixed price The beer and whisky classes are subclasses of the commodity class and...

Ngày tải lên: 09/03/2014, 01:20

8 210 0
Stream Prediction Using A Generative Model Based On Frequent Episodes In Event Sequences doc

Stream Prediction Using A Generative Model Based On Frequent Episodes In Event Sequences doc

... one automaton per candidate episode All automata are initialized at the start of every sequence, Xi ∈ DY , and the automata make transitions whenever suitable events appear as we proceed down ... destroying the salient aspects of search behavior that are necessary for predictive analysis Downey et al [3] already introduced formal models and languages that encode search behavior as character sequences, ... between frequent itemsets and generative models has already been established [7]) A mixture of generative models for transaction databases also has a wide range of applications We will explore these...

Ngày tải lên: 23/03/2014, 13:20

9 498 0
Báo cáo hóa học: " Sensitive and molecular size-selective detection of proteins using a chip-based and heteroliganded gold nanoisland by localized surface plasmon resonance spectroscopy" pptx

Báo cáo hóa học: " Sensitive and molecular size-selective detection of proteins using a chip-based and heteroliganded gold nanoisland by localized surface plasmon resonance spectroscopy" pptx

... functionalized and activated nanoisland In the first step, a mixed self-assembled monolayer (SAM) of MPA and DT on the gold nanoisland was prepared by treatment with different volumetric ratios ... binary SAM containing MPA and DT was fabricated on the gold nanoislands Because the two thiol derivaties, MPA and DT, have different hydrophilicities as well as different chain lengths, the nanometerscale ... cm) in a vacuum at a temperature of 65°C The substrate was then annealed at 200°C for h to produce more stable and ordered gold nanoislands Two different types of gold nanoislands (1- and 5-nm thickness)...

Ngày tải lên: 21/06/2014, 04:20

7 433 0
Báo cáo khoa học: "The study of tree fine root distribution and dynamics using a combined trench and observation window method" doc

Báo cáo khoa học: "The study of tree fine root distribution and dynamics using a combined trench and observation window method" doc

... various observation methods and techniques are discussed of A trench and an observation window tested in order to estimate root distribution and growth in a natural oak-birch stand in central ... square (4 on the &dquo;right&dquo; side, numbered 4, and on &dquo;left&dquo; side, numbered - 5-8) Additional data : to simplify tedious elongation measurements, an attempt was made to use infrared ... any vector h, the mathematical expectancy and variance of the increment F(X + h) - F(X) are of X and depend only on h independant The variogram g(h) is half the secondorder moment of the random...

Ngày tải lên: 09/08/2014, 02:21

8 266 0
Studying the physics of design flow incorporating early information using a simulation model

Studying the physics of design flow incorporating early information using a simulation model

... event simulation (DES) has been found to be very effective (e.g Ahuja and Nandakumar, 1985; Chua and Li, 2002; Lee and Arditi, 2006; Senior, 1995) As argued by Lee and Arditi (2006), discrete event ... Formulation and Model Development with GA Search Approach Result and Analysis Chapter Seven: Case Study Result and Analysis Optimal Strategy for Overlapping Chapter Eight: Conclusions and Recommendations ... produced by a preceding activity, whereas a mark above the diagonal represents that an activity is dependent on Table 2.1 DSM in order to show the dependency Activity A1 A2 A3 A4 A5 A6 A7 A1 A2 ...

Ngày tải lên: 11/09/2015, 10:18

290 268 0
Analysis of the proposed china asean free trade area a gravity model and RCAI approach

Analysis of the proposed china asean free trade area a gravity model and RCAI approach

... Antarctic Territories Wallis and Futuna Islands Mayotte Saint Pierre and Miquelon Aruba Netherlands Antilles Anguilla Cayman Islands Falkland Islands South Georgia and South Sandwich Islands ... Conga Djibouti Egypt Southern Africa Eritrea Ethiopia Kenya Madagascar Malawi Mauritius Namibia Rwanda Seychelles Sudan Swaziland Uganda Zambia Zimbabwe East African Cooperation Kenya Tanzania ... Korea Romania Singapore Sri Lanka Sudan Thailand Trinidad and Tobago Tunisia United Republic of Tanzania Uruguay Venezuela Vietnam Yugoslavia Zaire Zimbabwe Latin American Integration Association...

Ngày tải lên: 30/09/2015, 13:36

139 885 0
AN1292 sensorless field oriented control (FOC) for a permanent magnet synchronous motor (PMSM) using a PLL estimator and field weakening (FW)

AN1292 sensorless field oriented control (FOC) for a permanent magnet synchronous motor (PMSM) using a PLL estimator and field weakening (FW)

... Chandler and Tempe, Arizona; Gresham, Oregon and design centers in California and India The Company’s quality system processes and procedures are for its PIC® MCUs and dsPIC® DSCs, KEELOQ® code ... The PMSM mathematical modeling depends on its topology, differentiating mainly two types: surface-mounted and interior permanent magnet Each type has its own advantages and disadvantages with ... which are read every estimator cycle The stator’s inductance (LS) and resistance (RS) in Equation 4, are normalized and adapted to ease the computation and to satisfy the software representation...

Ngày tải lên: 11/01/2016, 17:05

20 436 0
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

... consider the boundary value b j,i-1 and modify our transition assumptions for P ROMODES H in such a way that the new algorithm applies a first-order boundary model and a second-order transition model ... calibrated threshold Conclusions We have presented a method to learn a calibrated decision threshold from a validation set and demonstrated that ensemble methods in connection with calibrated decision ... analysis based on relative word positions and found out that the calibrated P ROMODES -H predicted non-boundaries better for initial word positions whereas the calibrated P ROMODES for midand...

Ngày tải lên: 20/02/2014, 04:20

9 558 0
Báo cáo " Calibration and verification of a hydrological model using event data " ppt

Báo cáo " Calibration and verification of a hydrological model using event data " ppt

... This leads to the demand that we have to calibrate and validate the hydrological model using the individual storm events The traditional calibration method with the event data is trialand-error, ... evaporation data as input for the model The daily evaporation data at Khe Sanh station were used as inputs for the model For the model calibration and verification, discharge data is required The study ... study is MIKE-NAM model There are nine main parameters needed to calibrate and verify in this model Data required by the model include rainfall, evaporation and discharge In order to illustrate...

Ngày tải lên: 22/03/2014, 12:20

11 441 0
báo cáo hóa học:" Comparison of the effects of vitamin D products in a psoriasis plaque test and a murine psoriasis xenograft model" docx

báo cáo hóa học:" Comparison of the effects of vitamin D products in a psoriasis plaque test and a murine psoriasis xenograft model" docx

... Immunohistochemicalpsoriasis xenograft SCIDbiopsy before (A, B and C) transplantation and after (D, E and F) transplantation Immunohistochemical stainings of a keratome biopsy before (A, B and C) transplantation ... PHK did the immunohistochemical evaluations, LS designed and conducted the animal studies, OH did the statistical analysis, VH organised the clinical study, KK and MAR participated in the design ... tolerated and no significant weight loss was observed Two hours after the last application, the animals were bled and sacrificed The serum levels of calcipotriol and BDP were analyzed and determined...

Ngày tải lên: 18/06/2014, 15:20

9 534 0
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

... Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma ... TGTTGACAGYCVTT CCKGGT TAYTTTAAAARGTGTCMAGTGT CTYTTAAAAGGKGTCCAGWG CYTTTAMATGGTATCCAGTGT ATGGCAGCWGCYCAAAG CTTTTAAAAGWTGTCCAGKGT CTTCCTGATGGCAGTGGTT TAACCCTTGACCAGGCATCC Key to degenerate nucleotides: ... TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG AGGTVVAGCTGCAGVAGTCWGG ACTGCAGGTRTCCACTCC RCTACAGGTGTCCACTCC GCYACAGMTGTCCACTCC ACTGCAGGTGTCCTCTCT RCTRCAGGYGTCCACTCT CCAAGCTGTGTCCTRTCC...

Ngày tải lên: 18/06/2014, 22:20

10 541 0
báo cáo hóa học:" Research Article Using a State-Space Model and Location Analysis to Infer Time-Delayed Regulatory Networks" potx

báo cáo hóa học:" Research Article Using a State-Space Model and Location Analysis to Infer Time-Delayed Regulatory Networks" potx

... gene-expression data The tool has been demonstrated on artificial data and yeast cell-cycle gene-expression data Using the yeast microarray data, we have illustrated that our model can help identify regulatory ... earlier work we developed a state-space model with time delay to model yeast cell-cycle data [12], and the model was demonstrated on nonreplicated data Our previous method [12] emphasized identification ... 3.1 Data Sets Two data sets are used in this study First, an artificial data set is created to validate the model There are several methods proposed in the literature to create appropriate artificial...

Ngày tải lên: 21/06/2014, 20:20

14 545 0
Báo cáo khoa học: "Simulated soil CO2 efflux and net ecosystem exchange in a 70-year-old Belgian Scots pine stand using the process model SECRETS" pps

Báo cáo khoa học: "Simulated soil CO2 efflux and net ecosystem exchange in a 70-year-old Belgian Scots pine stand using the process model SECRETS" pps

... (unpublished data) ” ” Unpublished data Default Gond (unpublished data) Sampson (unpublished data) Sampson (unpublished data) ” Janssens (unpublished data) Default Default Minimum cuticular stomatal ... this sand layer, at a depth of 1.5 to m, lies a clay lens (Tiglian) and, deeper still, more sand (sands of Brasschaat, Pretiglian; [2]) The soil has been described as a moderately wet sandy soil ... exercise as discussed below Daily C and N inputs and outputs from the surface and soil sub-module are determined by needle litter-fall (C and N), fine root turnover (C and N), root exudation (C), and...

Ngày tải lên: 08/08/2014, 14:21

17 359 0
w