current progress in adoptive t cell therapy of lymphoma

Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx

Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx

... Consequently, tyrosines located on the peptides may be expected to exhibit the same kinetics as those located on the intact protein Therefore, determination of the kinetics of phosphorylation of these ... phosphorylation of His-cTCRf tyrosine 1N with time of incubation with Lck The levels of fragment (containing tyrosine 1N) detected with and without phosphate, after 0, and 30 of incubation with Lck ... be introduced to the observed phosphorylation kinetics, as its site of binding on TCRf may in uence the ability of its catalytic domain to reach the remaining unphosphorylated tyrosines of TCRf...

Ngày tải lên: 08/03/2014, 02:20

8 573 0
báo cáo hóa học:" Identification of a public CDR3 motif and a biased utilization of T-cell receptor V beta and J beta chains in HLA-A2/Melan-A-specific T-cell clonotypes of melanoma patients" potx

báo cáo hóa học:" Identification of a public CDR3 motif and a biased utilization of T-cell receptor V beta and J beta chains in HLA-A2/Melan-A-specific T-cell clonotypes of melanoma patients" potx

... an important role of the TRB chain in fine-tuning TR affinity of Melan-A-specific T cells of melanoma patients and argues against the hypothesis that high affinity TRs against self-Ags, like Melan-A, ... prognostic information, contributing to the design of efficient antimelanoma vaccines Competing interests The authors declare that they have no competing interests Authors' contributions FS, and ... Frequent contribution of T cell clonotypes with public TCR features to the chronic response against a dominant EBV-derived epitope: application to direct detection of their molecular imprint on the...

Ngày tải lên: 18/06/2014, 15:20

14 532 1
Báo cáo sinh học: " Biomarkers in T cell therapy clinical trials" potx

Báo cáo sinh học: " Biomarkers in T cell therapy clinical trials" potx

... cells in patients is most commonly described in terms of peripheral T cell persistence and homing to target tissues For most T cell therapy trials the total amount of T cell product infused into ... infused into patients is a fraction of the total patient T cell load, typically no more than 0.1% of the total However, since most current clinical protocols that involve adoptive T cell transfer ... to evaluate T cell bioactivity Insights about product bioactivity can often be obtained by evaluating the impact of the treatment on patient biology A classic example of this is the delayed-type...

Ngày tải lên: 18/06/2014, 22:20

9 380 0
Báo cáo y học: "Immune restoration disease and changes in CD4+ T-cell count in HIV- infected patients during highly active antiretroviral therapy at Zewditu" ppsx

Báo cáo y học: "Immune restoration disease and changes in CD4+ T-cell count in HIV- infected patients during highly active antiretroviral therapy at Zewditu" ppsx

... nature of our retrospective study Soon after the initiation of HAART, it was observed that some patients presented with initial or recurrent episode of cryptococcal meningitis during the first ... development of IRD Therefore, strict following of patients during the first three months of HAART initiation and diagnosis of latent TB [31] would help to prevent complications related to TB/IRD ... infections at time of HAART initiation in HIV- infected patients, at Zewditu Memorial Hospital, Addis Ababa, Ethiopia Types of previous OIs Frequency (%) Types of OIs at time of HAART initiation...

Ngày tải lên: 10/08/2014, 05:21

7 332 0
Báo cáo y học: "Elevated expression of CD30 in adult T-cell leukemia cell lines: possible role in constitutive NF-κB activation" pps

Báo cáo y học: "Elevated expression of CD30 in adult T-cell leukemia cell lines: possible role in constitutive NF-κB activation" pps

... possessed the intact kinase domain and the N-terminal amino acid deletion, starting at codon 417 It has been reported that the N-terminus of NIK contains a negative-regulatory domain and an N-terminal ... overexpression of CD30 might be at least one of the factors that contributes to constitutive NF-κB activation in ATL cell lines In HTLV-1 transformed cells, NF-κB activation is thought to be largely ... thought to contribute to the deregulated proliferation of HTLV-1-infected cells Accumulating evidence suggests that activation of cellular genes by Tax1, particularly through the nuclear factor-kappaB...

Ngày tải lên: 13/08/2014, 09:21

12 407 0
Báo cáo y học: " The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells" potx

Báo cáo y học: " The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells" potx

... associated kinase activity in HTLV-1 infected cells by binding to p16/INK4A, resulting in the inability of p16/INK4A to effectively inhibit cyclin D/ cdk4,6 complexes [57,58] The interaction of Tax ... HTLV-1 infected cells exhibited to times more cdk2 kinase activity than uninfected cells To verify that the observed increase in cyclin E/cdk2 kinase activity in HTLV-1 infected cells was not ... terminus [20] p21/waf1 (mut) is mutated at the N-terminus and is therefore still able to bind to cyclins through the C-terminus, making this protein a possible transdominant mutant Finally, to...

Ngày tải lên: 13/08/2014, 13:20

17 308 0
Báo cáo y học: " Role of Tax protein in human T-cell leukemia virus type-I leukemogenicity" pps

Báo cáo y học: " Role of Tax protein in human T-cell leukemia virus type-I leukemogenicity" pps

... HTLV-1 LTR or from other promoters, the strongest activation by Tax is detected with the TATAA box of the HTLV-1 LTR, indicating that this TATAA box contains a specific Tax responsive element ... Furthermore, these studies have also revealed that beside of the enhancing effect Tax on the association of the TATAA-box binding protein (TBP) to the TATAA site, Tax has an additional stimulatory ... not affect their growth rate and ability to form tumors in animals [230], indicating that Tax was involved only in the initiation of the invivo tumorigenic process, after which the cells continued...

Ngày tải lên: 13/08/2014, 13:20

24 409 0
Báo cáo khoa học: Transthyretin and familial amyloidotic polyneuropathy Recent progress in understanding the molecular mechanism of neurodegeneration pdf

Báo cáo khoa học: Transthyretin and familial amyloidotic polyneuropathy Recent progress in understanding the molecular mechanism of neurodegeneration pdf

... mechanism of TTR-induced neurotoxicity is presented (Fig 3) In this model, amyloidogenic mutations in TTR destabilize the native structure of the tetramer and induce dissociation of the tetramer into ... et al [146] have shown that the susceptibility of cells to amyloid toxicity is related to the capacity of the cells to buffer the intracellular calcium concentration This suggests that disruption ... plasma, TTR is present at a concentration of 0.25 gÆL)1 [65,66] The structure of a TTR dimer is shown in Fig Native TTR is a tetramer and contains two identical thyroxine-binding sites located in...

Ngày tải lên: 07/03/2014, 10:20

14 488 0
CURRENT PROGRESS IN BIOLOGICAL RESEARCH docx

CURRENT PROGRESS IN BIOLOGICAL RESEARCH docx

... nucleotide (T) deletion Mutated Sequence …ATGGGCAAATATAGCATTCCATAAAAAATATA… Original Sequence …ATGGGCAAATATAGCATTCCATAAAAATATATA…   A single nucleotide (G) insertion …ATGGGCAAATATAGCATTCCATAAAGAATATATA… ... …ATGGGCAAATATAGCATTCCATAAAGATATATA… Original Sequence …ATGGGCAAATATAGCATTCCATAAAAATATATA… A transversion (A to C) …ATGGGCAAATATAGCATTCCATAAACATATATA… Mutated Sequence Figure Base substitutions type of gene mutations Figure ... problems in the identification of biogeographical patterns [44]) As it is often difficult to distinguish whether the identified patterns result from singularities of the data or properties of the methods,...

Ngày tải lên: 08/03/2014, 19:20

394 5,5K 0
Plants in Alpine Regions Cell Physiology of Adaption and Survival Strategies pptx

Plants in Alpine Regions Cell Physiology of Adaption and Survival Strategies pptx

... westerly, often bringing moist air from the Atlantic Precipitation will then shift to the central and northern parts of the Alps, starting in the west and continuing to the east As the flow turns ... wetter than the climate of the outer air On sunny days the temperature at the surface of vegetation is higher than that of the air above it Bioclimate is determined by the height of the plant ... 2009), they will not be threatened The reduction of glutathion contents should be investigated in more detail as it points to an interesting adaptation in the network of reducing compounds, such...

Ngày tải lên: 14/03/2014, 09:20

215 781 0
Báo cáo sinh học: "High ERCC1 expression predicts cisplatin-based chemotherapy resistance and poor outcome in unresectable squamous cell carcinoma of head and neck in a betel-chewing area" pdf

Báo cáo sinh học: "High ERCC1 expression predicts cisplatin-based chemotherapy resistance and poor outcome in unresectable squamous cell carcinoma of head and neck in a betel-chewing area" pdf

... drafted the manuscript CYC and HTT participated in the interpretation of data and conducted immunohistochemistry analysis SHL collected the clinical data of patients and performed statistical data ... of patients to validate this finding Conclusion This present study suggests that ERCC1 mediated repair of DNA damage contributes to the clinical outcome in Acknowledgements Sources of support: ... survival in patients with unresectable HNSCC being treated with cisplatin-based IC followed by CCRT Methods Patients and treatment A total of 57 patients with pathologically proven locally advanced inoperable...

Ngày tải lên: 18/06/2014, 19:20

8 692 0
Báo cáo y học: " ytotoxic T cell recognition of an HIV-1 reverse transcriptase variant peptide incorporating the K103N drug resistance mutation" pot

Báo cáo y học: " ytotoxic T cell recognition of an HIV-1 reverse transcriptase variant peptide incorporating the K103N drug resistance mutation" pot

... tailored therapy against HIV Competing interests The author(s) declare that they have no competing interests Abbreviations Because of the relatively long half life of efavirenz, patients who simultaneously ... sensitive test for antigen-specific T cell activity [15] By this method, we found the region around mutation K103N to be reactive to T cells in of the 10 subjects using 18-mer 103N mutant peptides ... according to the manufacturer's instructions Briefly, the plates were washed then incubated with INF-γ detection antibody (Endogen) After washing, plates were incubated with streptavidin-AP conjugate...

Ngày tải lên: 10/08/2014, 05:20

4 261 0
Báo cáo y học: "Lymphopenia is an important prognostic factor in peripheral T-cell lymphoma (NOS) treated with anthracycline-containing chemotherapy" docx

Báo cáo y học: "Lymphopenia is an important prognostic factor in peripheral T-cell lymphoma (NOS) treated with anthracycline-containing chemotherapy" docx

... patients were treated with anthracycline-containing chemotherapy (e.g., CHOP or CHOPlike regimens) as first-line treatment and 15 (11.3%) were treated without anthracycline-containing chemotherapy ... performed data interpretation and revising it critically for intellectual content SJK involved in acquisition of data, analysis of data HAJ involved in acquisition of data, analysis of data SJK involved ... chemistry were performed at the time of diagnosis and prior to treatment No patients showed clinical signs of severe infection at the time of laboratory testing The study protocol was approved by the...

Ngày tải lên: 10/08/2014, 21:23

9 314 0
báo cáo khoa học: "An unusual presentation of precursor T cell lymphoblastic leukemia/lymphoma with cholestatic jaundice: case report" pot

báo cáo khoa học: "An unusual presentation of precursor T cell lymphoblastic leukemia/lymphoma with cholestatic jaundice: case report" pot

... cells about twice the size of lymphocytes, whereas T cell Lymphomas are composed of neoplastic T lymphocytes The tumor cells in this patient were cytokeratin negative indicating their non-epithelial ... manifestations of precursor T- ALL /T- LBL, namely, the rare initial presentation of cholestatic jaundice and the aberrant expression of synaptophysin by the tumor cells both of which, to the best of ... represent an intermediate intrathymic maturation stage for T lymphoblasts The lack of tumor cell expression of CD34 and TdT markers, as seen in this patient, is more common in precursor T- ALL than in...

Ngày tải lên: 10/08/2014, 22:20

6 340 0
Báo cáo y học: " Human T-cell leukemia virus type 2 Tax protein induces interleukin 2-independent growth in a T-cell line" ppt

Báo cáo y học: " Human T-cell leukemia virus type 2 Tax protein induces interleukin 2-independent growth in a T-cell line" ppt

... proteins has a growth promoting activity in T- cells, thus suggesting that this growth promoting activity of Tax2 contributes to HTLV-2-mediated T- cell transformation Since at least two functions, ... 5'-TGTGTCCGTCGTGGATCTGA-3' and 5'-TTGCTGTTGAAGTCGCAGGAG-3' mally activates NFAT, and thus CsA can not inhibit the cell growth of any HTLV-1-transformed T- cell lines [37] NFAT-inducible T- cell ... conferring resistance to CsA in Tax2-transformed CTLL-2 cells In contrast to Tax2, the cell growth of Tax1-transformed cells was little affected by CsA This finding is also consistent with the result...

Ngày tải lên: 13/08/2014, 09:20

7 239 0
Báo cáo y học: "Extracorporeal cell therapy of septic shock patients with donor granulocytes: a pilot study" doc

Báo cáo y học: "Extracorporeal cell therapy of septic shock patients with donor granulocytes: a pilot study" doc

... at the beginning of the extracorporeal treatment followed by a continuous infusion into the circuit Heparin administration was adjusted to maintain activated clotting time (ACT) between 150 to ... effect on the functionality (that is, oxyburst) of myeloid cell lines, indicating a neutrophil functioninhibiting milieu in all patients (data not shown) This is in line with reports in the literature ... beginning to 58 ± 15% at the end of the treatments, and improved slightly over the following 12 h to 61 ± 15% Both activated partial thromboplastin time (aPTT) and prothrombin time (as International...

Ngày tải lên: 14/08/2014, 07:21

13 485 0
Báo cáo sinh học: " AAV2-mediated in vivo immune gene therapy of solid tumours" potx

Báo cáo sinh học: " AAV2-mediated in vivo immune gene therapy of solid tumours" potx

... vector in an attempt to saturate the tumour with vector solution This notwithstanding, it is unlikely that there is a requirement for transduction of every tumour cell, as the mechanism of tumour ... presentation to T cells in the draining lymph node Co-stimulatory molecules are essential for correct T cell activation and subsequent differentiation into effector T cells following their interaction ... experiments, a single intramuscular injection was carried out into the right or left thigh of the animal Mice were anaesthetized during all treatments by intraperitoneal (IP) administration of 200...

Ngày tải lên: 14/08/2014, 19:22

13 152 0
The use of gold nanostructures in the imaging and therapy of cancer

The use of gold nanostructures in the imaging and therapy of cancer

... used to remove the uneven tissue contour for imaging The top row of images show the skin on the left of the interface while the bottom row of images show the skin on the right of the interface…………………………………………………… ... assessed in vitro The optical properties of gold nanoshells in non-biological tissue phantom models are examined under the OCT to investigate the different factors affecting the optical contrast in tissue ... subsequently exposing them to light for minutes to give a PTT light dose of 1.44 J/cm2………… 270 Figure 9.5 Cell viability after the individual PDT and PTT as well as the combined treatment The conditions...

Ngày tải lên: 11/09/2015, 09:02

317 435 0
w