creating a web based mailing

... that contains all logic data of application Separating logic data from application into it will make program scalable and higher performance Most of web applications today use Relational Database ... operating system - Easy to manage, update database: Database is located at dedicated server that managers can maintain and update it easily - Quick delivery: web- based model make it portable to be delivered ... System There are many kinds of GIS applications: desktop -based GIS, web- based GIS, and mobile -based GIS The most popular GIS applications are desktop -based, almost of them have database included...

Ngày tải lên: 27/10/2012, 16:40

... mySqlConnection.CreateCommand(); mySqlCommand.CommandText = selectString; SqlDataAdapter mySqlDataAdapter = new SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; DataSet myDataSet = new DataSet(); ... Northwind database and returns a DataSet containing rows from the Customers table You pass a WHERE clause to the RetrieveCustomers() method in the whereClause parameter; this WHERE clause is then ... Northwind database Because the code uses classes in the System.Data.SqlClient namespace, you'll also need to add the following line near the top of your Customers.asmx.cs file: using System.Data.SqlClient;...

Ngày tải lên: 28/10/2013, 19:15

... within a standard The standard associated with certifications is an American National Standard and an ISO/IEC Standard 17024 It addresses the requirements of a certification program that looks at ... organizations and, since 2009, educational certificate programs based on American National Standards or ISO International Standards To date, ANSI has accredited 30 certification bodies, and is ... credentials are expensive These pathways are not always available in all locations and competencies And analyses of job task analyses and knowledge, skills, and abilities are sometimes defined or assessed...

Ngày tải lên: 16/02/2014, 03:20

... and plan for a strategy in educational management of organizations in Vietnam and Asia [3] However, there are no DSS applications to apply a real case in the domain of an evaluation and a strategic ... of Web- based DSS application for various purposes in educational management In addition, the Web- based DSS application has implemented in a good security on web application standard so that the ... standards have been adopted by more than 74 countries as national standards for quality assurance The representative of ISO for the USA is the American National Standards Institute (ANSI) and...

Ngày tải lên: 05/03/2014, 14:20

... Harlan Hiley, Ramakrishna Vedantham, Gregory Cuellar, Alan Liuy, Natasha Gelfand, Radek Grzeszczuk, and Gaetano Borriello 2008 Landmark -based pedestrian navigation from collections of geotagged ... interface between the navigation systems and the database 3.6 Web- based client The web- based client is a JavaScript/HTML program running on the user’s web browser software (e.g Google Chrome) A snapshot ... (GIVE): A challenge and evaluation testbed for NLG In Proceedings of the Workshop on Shared Tasks and Comparative Evaluation in Natural Language Generation Robert Dale, Sabine Geldof, and Jean-Philippe...

Ngày tải lên: 07/03/2014, 18:20

... 2002), a suite of text processing and annotation tools, and U-Compare (Kano et al., 2010), a standalone application supporting the UIMA framework that formed the inspiration for Argo Although ... to transform some or all of the annotations and/or the subject of annotation from the CAS and serialise it into some storable format Readers, analysers and consumers are represented graphically ... Cunningham, D Maynard, K Bontcheva, and V Tablan 2002 GATE: A framework and graphical development environment for robust NLP tools and applications In Proc of the 40th Anniversary Meeting of the Association...

Ngày tải lên: 16/03/2014, 20:20

... statistical machine translation methods acquire their translation knowledge in form of large phrase translation tables automatically from large amounts of translated texts (Koehn et al., 2003) For each ... words and advanced users with suggestions that are not part of their active vocabulary It may be possible that these options even allow users that not know the source language to create a translation, ... computer aided translation tool caitra that allows us to compare industrystandard post-editing, the interactive sentence completion paradigm, and other help for translators The tool is available...

Ngày tải lên: 17/03/2014, 02:20

... DARPA Speech and NL Workshop M Walker, D Litman, C Kamm, and A Abella 1997 PARADISE: A general framework for evaluating spoken dialogue agents In Proc ACL/EACL M Walker, D Litman, C Kamm, and A Abella ... combine all of our data (48 dialogues), and perform a two-way ANOVA for each evaluation measure as a function of strategy and task An interaction between response strategy and task scenario is ... seventh train leaves at 5:OOpm on Saturda); and it takes I hour 12 rains Please say "list" to hear trains at a time, or say "add constraint" to constrain your departure time or travel day, or say "continue"...

Ngày tải lên: 17/03/2014, 07:20

... Learning, pages 152–164 Association for Computational Linguistics Hamish Cunningham, Diana Maynard, Kalina Bontcheva, Valentin Tablan, Niraj Aswani, Ian Roberts, Genevieve Gorrell, Adam Funk, Angus ... judgement for each annotation As a specific realisation based on this approach, we have integrated a recently introduced machine learning -based semantic class disambiguation system capable of offering ... separate “save” operation and thus a minimal risk of data loss, and as the authoritative version of all annotations is always maintained by the server, there is no chance of conflicting annotations...

Ngày tải lên: 17/03/2014, 22:20

... indicate that among voluntary participating employees, a web- based HRA program with tailored feedback could motivate those in greatest need of health-behaviour change A web- based HRA with tailored ... no, and not applicable Analysis All analyses included descriptive statistics to examine population characteristics, and questionnaire answers for satisfaction and initial health-behaviour change ... previous satisfaction studies generally evaluated a service that was based on face-to-face encounters with health professionals The web- based HRA program we studied is a highly automated health service...

Ngày tải lên: 20/06/2014, 00:20

... of web page layout and design HCI-2 Clear organization and presentation of information HCI-3 Consistent and easy to use web site navigation HCI-4 Aesthetically pleasing design and graphics Evaluation ... faculty Graham, Cagiltay, Craner, Lim, & Duffy: Teaching in a Web Based Distance Learning Environment unparalleled in the past Students often assume that instructors have easy, constant access to ... each topic or assignment and making that person responsible for encouraging and 17 Graham, Cagiltay, Craner, Lim, & Duffy: Teaching in a Web Based Distance Learning Environment stimulating quality...

Ngày tải lên: 28/06/2014, 21:20

... [http://www.ebi.ac.uk/ena/ data/view/ERP000619] 28 Affymetrix - Sample Data, Exon 1.0 ST Array Dataset [http://www affymetrix.com/support/technical/sample_data/exon_array_data.affx] 29 Akira S, Takeda K: ... 25:1105-1110 Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, Salzberg SL, Wold BJ, Pachter L: Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and ... data Brad A Friedman1,2,3* and Tom Maniatis4 Abstract RNA-Seq and microarray platforms have emerged as important tools for detecting changes in gene expression and RNA processing in biological...

Ngày tải lên: 09/08/2014, 23:20

... the data analyses and counted as dropout (cut-off: answered at least 70% of the questions) Data Analysis Data will be analysed according to the intention-to-treat principle Multiple imputations ... criteria will create a personal and secure login and password (with automated real-time verification of the passwords’ security level) and will receive an automated e-mail notification with their access ... or a professional from Page of the medical advisory and emergency list that will be accessible at all times and how to make this contact The participants will also be informed that the study has...

Ngày tải lên: 11/08/2014, 15:22

... strains in a published global mutagenesis dataset Software allowing constraint -based simulations of M tuberculosis metabolism via a web- based interface was developed in order to make our model available ... associations, rather than being modeled by duplication of reactions (see Materials and methods) The reaction formulae, FBA parameters, and geneprotein associations are summarized in Additional data ... Result of flux variability analysis (FVA) simulation Maximal theoretical growth rate is displayed at the top of the page Each row in the table contains reaction name maximal and minimal flux consistent...

Ngày tải lên: 14/08/2014, 07:21

... Pandey et al [39] (Table 2): three gamma-proteobacteria (E coli as an AT-rich generic model, Coxiella burnetii as an obligate host-associated organism and Pseudomonas aeruginosa as a free living, ... given bacterial genome: Rapid Automated Scan for Toxins and Antitoxins in Bacteria (RASTA-Bacteria) This method is based on the genomic features associated with toxins and antitoxins and the existence ... genome architecture (it works with linear and circular chromosomes from to less than Mb, megaplasmids, plasmids), G+C content, bacterial classification (Gram+ and GramEubacteria, Archaea), and lifestyle...

Ngày tải lên: 14/08/2014, 08:20

... unbranded food items, automatically calculating an estimate of calorie intake A daily exercise diary encourages additional physical activity by setting a target to expend a minimum of an extra ... dependent variable was percentage weight loss, and initial BMI, and duration of programme use were included as covariates Age was not included as a covariate as it was not associated with percentage ... acknowledged Authors’ contributions FJ planned the analysis strategy, analyzed the data and drafted the article in collaboration at all stages with JW Both authors read and approved the final manuscript...

Ngày tải lên: 14/08/2014, 08:20

... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGAGGATGACACTTCGGCCGATGAG>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>CAGGATAAGGAGATTGATCTGCCAGAGTCC ... add Clear User-Defined Exons Table mRNA (1802 nucleotides) AGCACCGCGCAGGCGCTGCGGAGCCGCGCGGAGGAAGTTTGAACG GTGGCGGGTACCGGAGCCGCTGATGGAGTCCGTGCTGAAAGGTAT ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA...

Ngày tải lên: 14/08/2014, 16:21

... Biology 2007, Additional data files The following additional data are available with the online version of this article Additional data file contains an illustrative example of the GENECODIS algorithm ... operation Additional data file contains the results obtained by GENECODIS in the analysis of the yeast and human gene sets Additional data file provides a description of a comparative analysis ... example genes that are differentially expressed among pathologic and normal tissues These data can provide a basis for the characterization of unknown genes, and at the same time they are also...

Ngày tải lên: 14/08/2014, 17:22

Ngày tải lên: 13/11/2014, 09:46

... Similar to a withdrawal Kanban except that that the retrieval of Subcontract Kanban materials is from a factory or storage location near the actual manufacturing plant Express Kanban Auxiliary Kanban ... for a manufacturing company that aims to improve and enhance their manufacturing system and operations The major advantages of a Web- based Kanban system is the availability of visible and real-time ... signal and place it in ‘on-hold’ status on Web- based Kanban screen [2] The withdrawal Kanban signal from Kanban screen will be translated to a production Kanban signal on Kanban screen located at...

Ngày tải lên: 04/10/2015, 15:45