... and the relevant mutant E1 In all assays, the E1aS283C and E1aF26 6A mutants behaved essentially the same as wild-type E1 In the DCPIP assay, the E1aY28 1A and E1aR28 2A mutants displayed a catalytic ... mixture with E1 was incubated for exactly 10 at the relevant temperature and the catalytic activity at that temperature was then determined The inactivation temperatures for all the E1 mutants were ... by addition of 14Clabelled pyruvate (1 lCi, about 60 nmol) after the assay mix had been incubated for 10 at 25 °C PDH assay This measures the rate of formation of NADH at 340 nm and 30 °C after...
Ngày tải lên: 20/02/2014, 23:20
... electron-withdrawing groups give a line with slope q = 0.70 For all three enzymatic reactions (GGT-catalyzed transpeptidation, and AGA-catalyzed and PGA-catalyzed hydrolysis), acylation is the ratelimiting step ... substrate, and the phenylmethanesulfonyl-SerB1 derivative These structures are mimics of the stationary points along the reaction pathway; they depict the changes in the spatial structure of the active ... [16], as are the calculations of Galabov et al concerning the energetics of the alkaline hydrolysis of N-phenylacetamides [19] The investigation of Perakyla et al on the catalytic reaction of AGA,...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo Y học: Identification of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt
... GraP was prepared from the water insuluble barium salt of D ,L -glyceraldehyde3-phosphate diethylacetal and the amount of GraP present was measured enzymatically [10] The enzyme was also assayed ... incubation, the enzyme activity in an aliquot of the incubation mixture was measured, which indicated that the enzyme activity was inactivated to the extent of 80 –90% From the residual part of the ... indicated concentrations of TNBS or PP was added in the respective tubes and incubated for 30 Then equal aliquots were taken from each tube and assayed for the enzymatic activity The enzymatic activity...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx
... subjects (CA genotype) was PCR amplified using a forward primer starting at nucleotide )622 (5¢-CCAAGACATACTAAGAATGG-3¢) and the same reverse primer ending at nucleotide +74 (5¢-GGCA GAGAAAACTCGAGAAC-3¢) ... demonstrate an allelespecific binding of nuclear factors and TFIID to the mutation containing sequence; ) 1A has less affinity than )1C Our novel data demonstrate that the )1C A mutation at the transcriptional ... polymerase (Stratagene, La Jolla, CA, USA) to eliminate the possibility of PCRinduced mutations The reactions were then denatured at 95 °C for and gradually reannealed by decreasing the temperature to...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo lâm nghiệp: "Macronutrients in tree stems and foliage: a comparative study of six temperate forest species planted at the same sites" pps
... (1.0) a Cation exchange capacity was determined as the sum of the extractable amounts of H+, Na+, K+, Ca+, Mg2+, Al3+, Fe3+ and Mn2+ from the BaCl2 extraction b Base saturation was calculated as the ... ash (Fig 1), which showed the lowest N concentrations at the least fertile Danish site (DK-1) and two Lithuanian sites At the Danish site the growth rate, was also probably affected (Tab I) although ... concentrations in leaves and wood biomass were analysed by analysis of the variances (ANOVA) with species and site as factors Only the main effects were analysed The Tukey – Kramer procedure (a variant...
Ngày tải lên: 08/08/2014, 01:22
Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university
... comprehension as a process of acquiring the meaning of the message based on the incoming language data from sounds, to words, to grammatical relationships, and ultimately to the meaning Schemata are hierarchically ... that traditional view was inappropriate and inadequate because the listener was regarded as a tape-recorder and the listener took in and stored aural messages in much the same way as a taperecorder ... vocabulary, grammar, or other target language elements Language based clues may come from aspect of the target language that the learner already knows, from the learners’ own language, or from another...
Ngày tải lên: 27/12/2013, 20:26
Tài liệu Báo cáo khoa học: Solution structure of hirsutellin A – new insights into the active site and interacting interfaces of ribotoxins docx
... peak data from NOESY spectra were analyzed in a semi-automated iterative manner by cyana 2.1 [38] The NOE coordinates and intensities used as input for automated analysis were generated automatically ... placed close to the catalytic H113, is in a similar orientation to that in the active site of nonspecific RNases These novel architectural features lead to new electrostatic interactions at the ... economical At the same time, the active site of HtA, as revealed by the 3D structure, shows a different arrangement to that shown by the classical ribotoxins, but catalyzes the same hydrolytic reaction...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Modulation of the enzymatic efficiency of ferredoxin-NADP(H) reductase by the amino acid volume around the catalytic site pptx
... FNR was amplified using oligonucleotides FNRC266L (5¢-GACAA CACTTTTGTCTACATGTTGGGACTGAAAGG-3¢) or FNRC266M (5¢-GACAACACTTTTGTCTACATGATGG GACTGAAAGG-3¢) and FNRlw1 (5¢-GTAATCTATCTA CAGAATACAGGAGGGTGATA-3¢) ... (5¢-ACTTTTGTCTACATGGC TGGAGCGAAAGGAATGG-3¢) or FNRG267V (5¢-ACTT TTGTCTACATGTGTGTACTGAAAGGAATGG-3¢) and FNRlw (5¢-TCAAGACCCGTTTAGAGG-3¢) as primers and plasmid pET205 as template After amplification, the product ... CAGAATACAGGAGGGTGATA-3¢) as primers and plasmid pCV105 [63] as template In addition, oligonucleotides FNRup1 (5¢-AACAAGTTCAAACCTAAGGAACCATA CG-3¢) and FNRC266Llw (5¢-CCTTTCAGTCCCAACA TGTAGACAAAAGTGTTGTC-3¢)...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc
... Molnes et al ATP binding at active site of human glucokinase Table The kinetic constants for WT GST–hGK at high and low concentrations of the fixed substrate The catalytic activity was measured at 37 ... related to partial catalytic activation following (Mg)ATP binding at physiological concentrations of Glc Similar or possibly larger effects of ATP in promoting a catalytically competent state may ... forward, 5¢-GC ATG ATC GTG GGC ATG GGC TG C AAT GCC TGC 3¢; T228 reverse, 5¢-GCA GGC ATT GCA GCC CAT GCC CAC GAT CAT GC-3¢; L146R forward, 5¢-CAC AAG AAG CTG CCC CGG GGC TTC AC C TTC TCC-3¢; and...
Ngày tải lên: 06/03/2014, 00:20
Mobilizing Climate Finance - A Paper prepared at the request of G20 Finance Ministers potx
... Organization (ICAO) and the International Maritime Organization (IMO) respectively RDB input to the synthesis paper was coordinated by Martin Poulsen at AfDB, Samuel Tumiwa at ADB, Josue Tanaka ... the U.S and Canada and the adoption of national mitigation targets in Japan, Australia and New Zealand, resulting in percent abatement Here carbon offset prices are estimated in a $15-25 range, ... countries that has been estimated as consistent with a 2C pathway 108 These estimates might be substantial under-estimates in that they not attempt to capture all of the broader changes in private investment...
Ngày tải lên: 06/03/2014, 08:21
Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot
... GCCAACACGATTTTCCTCCCAGTTGGAACGGCC GCCAACACGATTTTCAGCCCAGTTGGAACGGCC GCCAACACGATTTTCCGCCCAGTTGGAACGGCCv CCCTTCGCGCCCAACGCACTTACCCAAGGACCG CCCTTCGCGCCCAACGCAAGTACCCAAGGACCG CCCTTCGCGCCCAACGCACGCACCCAAGGACCG ... GGTCGGTCAATTGCGGCTCCTCGCGGCCGTATG GGTCTAGCTCTGTTCACGCCATGGTCATGATGCG GGTCTAGCTCTGTTCACTTCATGGTCATGATGCG CCGACCATTTGGCCCTTCCTGCTGCC CGCCAACACGATTGCCCACCCAGTTGGAACGG GCCAACACGATTTTACGACCAGTTGGAACGGC ... phosphate, pH 6.0, at 24°C) Benzyl alcohol Wild-type Km kcat kcat ⁄ Km Y7 8A Km kcat kcat ⁄ Km Y92F Km kcat kcat ⁄ Km L31 5A Km kcat kcat ⁄ Km F50 1A Km kcat kcat ⁄ Km F501Y Km kcat kcat ⁄ Km m-Anisyl...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt
... mutations were (positions of mismatches underlined): F14 4A: 5¢-CAA AAT GGG GCT GAC AAC TCC-3¢; F144Y: 5¢-CAA AAT GGG TAT GAC AAC TCC-3¢; F22 9A: 5¢-CAC GAT GCT GCC CAA GTC TTT-3¢; F25 8A: 5¢-TAC ... Initially, this appears to be an example of convergent evolution towards aromatic triads that can accommodate the twists specifically associated with b-1,3-glucan polymers The nature of the aromatic ... (A2 ) ˚ Average ligand B-factor (A2 ) BGC 1a ˚ Average ligand B-factor (A2 ) BGC2b ˚ Average ligand B-factor (A2 ) L3-1c ˚ Average ligand B-factor (A2 ) L3-2d ˚ Average ligand B-factor (A2 ) Ca ˚ Average...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx
... mM magnesium acetate, 60 lM [c-32P]-ATP (Amersham, UK), 25 nM of the catalytic subunit of PKA and lM of hPAH The reaction was performed at 30 C, and at timed intervals, aliquots of the reaction ... that on preincubation with saturating concentrations (Fig 3B) of the biopterin cofactors or dopamine the rate of phosphorylation was decreased, and at 200 lM of the ligands the inhibition was ... conformational states include a ground state for the ligand-free enzyme, an activated state with bound substrate (L-Phe), an inhibited state with bound H4biopterin and nally the state of catalytic...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf
... propionate CoAtransferase based on these data was glutamate 324 (Fig 3) Detection of glutamate 324 as the catalytic carboxylate of propionate CoA-transferase As the sequence analysis did not allow an unequivocal ... glutamate 324, which led us to conclude that this residue is the active site carboxylate The proteins most similar to propionate CoA-transferase in the databases are a putative acetoacetate CoAtransferase ... kJámol)1 acetate The enzymes involved are pyruvate:glutamate transaminase (1), glutamate dehydrogenase (2) (R)-lactate dehydrogenase (3), propionate CoA-transferase (4) (R)lactoyl-CoA dehydratase...
Ngày tải lên: 17/03/2014, 17:20
I bought a thick book at the bookstore yesterday potx
... thick book at the bookstore yesterday 2 Các bạn di chuột vào cụm từ để biết chức cụm câu: I bought a thick book at the bookstore yesterday 3 Tại câu lại dịch vậy? - I – dịch tôi/ tớ/ ta/ tao/ mình, ... cho danh từ theo sau Cụ thể làm rõ ngh a cho “bookstore” (ngh a hiệu sách, danh từ ghép - compound noun - hai danh từ đơn “ book” – sách store- hàng/ c a hiệu) Vì “bookstore” the nên ta hiểu ... - at : giới từ vị trí (preposition of place) có ngh a (một khoảng cách/ vị trí đó) Ví dụ at school” - trường - the bookstore : “ the mạo từ xác định (definite article), dùng để làm rõ nghĩa...
Ngày tải lên: 20/03/2014, 00:20
THE CHEMICAL HISTORY OF A CANDLE A COURSE OF LECTURES DELIVERED BEFORE A JUVENILE AUDIENCE AT THE ROYAL INSTITUTION ppt
... here a substance which is rather porous a column of salt and I will pour into the plate at the bottom, not water, as it appears, but a saturated solution of salt which cannot absorb more; so that ... obtain absolutely the flame of the candle at a place distant from it Now, look at that Is not that a very pretty experiment? Talk about laying on gas why, we can actually lay on a candle! And ... or against a clean plate, or any other cold thing, and another part was incondensable We will first take the condensable part, and examine it; and, strange to say, we find that that part of the...
Ngày tải lên: 22/03/2014, 14:20
Báo cáo Y học: Biosynthesis of vitamin B2 An essential zinc ion at the catalytic site of GTP cyclohydrolase II ppt
... GCAAATGGGATCCACAATGCAAGAGG CATTCCGAATCTCTGACTGGTGAC GTCACCAGTCAGAGATTCGGAATG GCTTGCTGTCTGATTGTGGCTTC GAAGCCACAATCAGAACGCAAGC GCGCTGCGATTCCGGCTTCCAGC GCTGGAAGCCGGAATCGCAGCGC Table Micro-organisms and plasmids ... strand of the ribA Designation Primer orientation MF BamH1rev P-C54S-f P-C54S-r P-C65S-f P-C65S-r P-C67S-f P-C67S-r + – + – + – + – Sequence ACACAGAATTCATTAAAGAGGAGAAATTAACCATG GCAAATGGGATCCACAATGCAAGAGG ... riboflavin biosynthesis are therefore putative targets for the treatment of infections caused by Gramnegative bacteria and possibly by Mycobacteria and pathogenic yeasts The exploration of novel anti-infective...
Ngày tải lên: 23/03/2014, 21:20
Breast Cancer In Younger Women - Proceedings Of A Conference Held At The National Institutes Of Health, Bethesda, Maryland, January 28, 1993 pot
... Ecuador El Salvador Granada Guatemala Guyana Haití Honduras Jamaica México Nicaragua Panamá Paraguay Perú República Dominicana Saint Kitts y Nevis San Vicente y las Granadinas Santa Luc a Surinam ... PAÍSES INDUSTRIALIZADOS Alemania Andorra Australia Austria Bélgica Canadá Chipre Dinamarca Eslovaquia Eslovenia Espa a Estados Unidos Estonia Finlandia Francia Grecia Hungr a Irlanda Islandia ... sistemas no dan abasto debido al SIDA y a la mortalidad asociada esta enfermedad En última instancia, aunque las causas de la mortalidad materna y de las lesiones y discapacidades relacionadas el...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: Kinetics of the quinone binding reaction at the QB site of reaction centers from the purple bacteria Rhodobacter sphaeroides reconstituted in liposomes docx
... purchased from association and dissociation (quinone exchange), both in the dark and in Avanti Polar Lipids Inc., Alabaster, AL, USA), and the charge separated state The constants in the scheme are ... lipid/detergent molar ratio Due to dispersion of the data for the same sample we conclude that an average value of 110 ± 25 nm can be 37 assumed as a reasonable estimate of the liposomes radius The measurements ... on the rate ratio between the quinone exchange and the charge recombination from the states D+QA– or D+QA–QB, in addition to Q/RC The quinone release rate kout[D+QA)QB] can be normalized to the...
Ngày tải lên: 30/03/2014, 20:20
Research on factors affecting the student’s satisfaction: a case study at the Da Nang University of economics, in Vietnam.
... students’ satisfaction is a shortterm attitude that results from evaluation of their experience on education services that they had received • Kotler and Clarke (1987) define satisfaction as a state ... configuration of the university image and its relationship with the satisfaction of students Journal of Educational Administration 17 Yu, Y and Dean, A (2001), The contribution of emotional satisfaction ... Quantitative research Observations Sample Selection Collective Data Process Data & Analysis information Research Result RESEARCH METHODS q This study will be adopted from Parasuraman’s SERVQUAL...
Ngày tải lên: 18/04/2014, 16:25