... your source features layer Processing Extent > set to same as your study area layer Raster Analysis > Cell Size > Maximum of Inputs In ArcToolbox, expand Spatial Analyst Tools > Distance > double-click ... Data Resource Centre, University of Guelph CREATING AND USING BUFFERS IN ARCGIS 10 . 1 Using the Euclidean Distance tool Open ArcMap Click Customize on the Main Menu and point to Extensions ... an area up and allocates each cell to the nearest input feature The Euclidean Allocation tool creates raster zones that show the locations that are closest to a given point If you specify a maximum...
Ngày tải lên: 17/03/2015, 09:34
... gigas Nature 405, 10 3 6 10 4 0 10 Hare, P.E (19 63) Amino acids in the proteins from aragonite and calcite in the shells of Mytilus californianus Science 13 9, 216 – 217 11 Hare, P.E & Abelson, P.H (19 65) ... 6.5 1. 2 1. 4 1. 3 1. 5 3.4 1. 4 NDa 1. 7 2 .1 2.86 10 . 8 1. 1 4.4 2.2 31. 5 30.5 1. 3 1. 9 1. 0 1. 2 5.9 1. 7 1. 4 1. 2 3.9 0.42 a ND, not determined After intensive dialysis the sample still contained residual ... major polysaccharide absorption region A band at 11 80 cm )1 was probably due to in- plane NH2 rocking It is also possible that the small bands located at 963, 985 and 10 3 2 cm )1 in the EDTA-SM and...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"
... qualified for Molecular Imaging in MRT Here we are at the beginning to evaluate the possibilities arising in the Molecular Imaging world 14 5 10 11 12 13 14 15 16 Acknowledgments This work was ... Gd-cluster@-BioShuttle 14 It was used to investigate whether an intracellular MR imaging is possible and to estimate the T1 relaxivity on MR (1. 5 T) Historically already in 19 94 electron-spin-resonance and mass-spectrometry ... grey-values and differential relaxation times are unsatisfactory so far, because radiation induced necrosis [58], vital tumor tissue and cerebral metastases are nearly undistinguishable.[ 51] Additionally,...
Ngày tải lên: 26/10/2012, 09:07
CHAPTER ELEVEN MIND MAPPING a NEW DIMENSION IN THINKING AND NOTE TAKING
... Outlining On page 10 9 is a Mind Map summarising a three-day Brain Training and Mind Mapping Course The Mind Map was made by a father who was also a company director He used the same Mind Map to ... Key words or phrases for main and secondary ideas from Kusa-Hibari main secondary paragraph paragraph paragraph paragraph paragraph Below you will find sample key words and phrases from the notes ... structure of the brain Advanced note taking and mapping techniques 86 NOTING Exercise In the space below, and starting immediately after having reached the end of this paragraph, prepare a half-hour speech...
Ngày tải lên: 09/08/2013, 11:51
Tài liệu Creating a New Access Database pptx
... @"Provider=Microsoft.Jet.OLEDB.4.0;Data Source=" + fileName + ";"; // Use ADOX to create the Access database ADOX.Catalog cat = new ADOX.Catalog( ); try { cat.Create(connectString); } finally { cat = null; } } Discussion ADO ... objects in a database You can use ADOX from NET through COM interop to create a new Microsoft Access database Use the Create( ) method of the ADOX.Catalog object, passing a connection string for ... Access database " + fileName + " created.", "Create Access Database", MessageBoxButtons.OK, MessageBoxIcon.Information); } catch (System.Exception ex) { MessageBox.Show("Could not create database...
Ngày tải lên: 24/12/2013, 05:15
Tài liệu Creating a New SQL Server Database doc
... defined using DDL The solution executes a DDL CREATE DATABASE statement to create a new database on a SQL Server You can programmatically drop the database by using the DROP DATABASE statement in ... statements generally require DBA permissions to execute Database Management Language (DML) Used to manipulate—select, insert, update, and delete—data in the database objects Database objects are ... statement in a similar way To drop the database created in the previous example, use the following code: DROP DATABASE MyDatabase The DROP DATABASE statement will fail if the database is in use; therefore,...
Ngày tải lên: 21/01/2014, 11:20
Tài liệu Báo cáo khoa học: "Discriminative Lexicon Adaptation for Improved Character Accuracy – A New Direction in Chinese Language Modeling" pptx
... adaptation by the proposed approach in Table LAICA -1 A D Baseline +17 43 -16 79 79.28 80.48 79. 31 LAICA-2 A+ D +17 43 -16 79 80.98 A D +409 -11 2 80.58 79.33 A+ D + 314 -88 81. 21 Table 3: ASR character accuracies ... 2002 Toward a unified approach to statistical language modeling for Chinese ACM Transaction on Asian Language Information Processing, 1( 1):3–33 Jianfeng Gao, Mu Li, Andi Wu, and Chang-Ning Huang 2004 ... PAT-tree Mutual Probability LAICA-2 (A+ D) # of ranked reference characters 70993 710 3 8 Average Rank 1. 92 1. 89 710 5 4 1. 81 710 8 3 1. 67 Table 6: Average ranks of reference characters in the confusion...
Ngày tải lên: 20/02/2014, 07:20
scientific american - 2002 06 - spintronics - a new twist in computing
... primates SOUTH CHINA SEA MALAYSIA BORNEO SUMATRA INDONESIA INDIAN OCEAN JAVA Present-Day Orangutan Range HUNDREDS OF THOUSANDS of orangutans roamed throughout Southeast Asia about 10 , 000 years ago, ... Thailand are based on a combination of clades B and E, and in April the International AIDS Vaccine Initiative expanded tests of a clade A derived vaccine in Kenya, where clade A is found But in January, ... representatives of Scientific American in all regions of the U.S and in other countries New York Scientific American 415 Madison Ave New York, NY 10 0 17 -11 11 212 -4 51- 8893 fax: 212 -754 -11 38 Los Angeles 310 - 234-2699...
Ngày tải lên: 12/05/2014, 16:12
a new dataset in the making
... Johanna Bötscher, Martina Castro, Kristina Hauser, Benjamin Hofmann, Theresa Kuhn, Salome Lang, Justin Leinaweaver, Julie Mandoyan, Martiño Rubal Maseda, Claudia Meier, Irina, Mirkina, Katharina ... Foreign Affairs and International Trade Canada website: http://www.international.gc.ca/tradeagreements-accords-commerciaux/agr-acc/index.aspx some information as to planning and process of coding and ... 0 10 15 Percentage 20 25 National treatment no National treatment yes Percentage America Oceania Region 30 Region Africa Europe Asia Africa America Oceania Region Cross Europe Asia Africa America...
Ngày tải lên: 02/06/2014, 09:22
Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc
... degradation and indirectly inhibiting all viral RNA transcription Proc Natl Acad Sci USA 2003, 10 0 :2 718 -2723 Gitlin L, Karelsky S, Andino R: Short interfering RNA confers intracellular antiviral ... OraQuick HIV -1 Cytolin Tipranavir HXB MEDI-4 91 Synagis™ (Palivizumab) Numax INS37 217 Intranasal MedImmune Nabi Biopharmaceuticals Protein Design Labs XTL Biopharmaceuticals Ltd Nabi Biopharmaceuticals ... Asthma PS DNA Phase II GTI 2040 EpiGenesis Pharmaceuticals Lorus Therapeutics Cancer PS DNA Phase II ISIS 10 4 838 Avi 412 6 ISIS AVI BioPharma Antiviral H-ras DNA methyl transferase Adenosine A1 receptor...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học: " Intention as an indicator for subjective need: A new pathway in need assessment" doc
... study and at the data acquisition followed by data preparation for the current analysis RP participated at data acquisition and data preparation for the current analysis TU participated in the ... of 10 References Asadi-Lari M, Packham Ch, Gray D: Need for redefining needs Health and Quality for Life Outcomes 2003, 1: 34 doi: 10 . 11 86 /14 77-7525 -1- 34 Bradshaw J: A taxonomy of social need In ... the manuscript Author Details 1Department of Mental Health and Cognitive Capacity, Federal Institute for Occupational Safety and Health, Noeldnerstrasse 40-42, 10 3 17 Berlin, Germany and 2Department...
Ngày tải lên: 20/06/2014, 00:20
Desiccant enhanced evaporative air-conditioning (DEVap): evaluation of a new concept in ultra efficient air conditioning docx
... diagram of a residential installation of DEVap A/ C showing the solar option 18 Figure 2 -15 Example diagram of a packaged DEVap A/ C 19 Figure 2 -16 Example diagram of a commercial installation ... remaining refrigerants used today (R 41 0A and R -13 4A) are strong contributors to global warming Their global warming potentials are 2000 and 13 00, respectively (ASHRAE 2006) Finding data on air ... does in building spaces only Today’s A/ C systems: • Maintain a healthy building environment o In commercial and new residential, A/ C provides ventilation air to maintain indoor air quality o A/ C...
Ngày tải lên: 27/06/2014, 14:20
Báo cáo y học: "Human depression: a new approach in quantitative psychiatry" pdf
... neurotransmitter) to form an active complex that mediates an intracellular event (for example, activation of adenylate cyclase) The Gα subunit is activated and starts a cAMP signalling cascade, as ... involved in the interpretation of the data All the authors have been involved in drafting and revising the manuscript and have read and approved the final manuscript Author Details 1DIMORFIPA, University ... Neurosci 2002, 22 :16 68 -16 78 doi: 10 . 11 86 /17 44-859X-9-25 Cite this article as: Cocchi et al., Human depression: a new approach in quantitative psychiatry Annals of General Psychiatry 2 010 , 9:25 ...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx
... 2003, 17 1:8939 01 Harada A, Sekido N, Akahoshi T, Wada T, Mukaida N, Matsushima K: Essential involvement of interleukin-8 (IL-8) in acute inflammation J Leukoc Biol 19 94, 56:559-564 Available online ... (CCR )1 blockade for 14 days in a patient with rheumatoid arthritis (haematoxylin–eosin staining; original magnification ×400) After active treatment there was a marked reduction in synovial cellularity, ... migration selectively [20] In that study a highly specific neutralizing antibody against IL-8 was administered in several types of acute inflammatory disease, including lipopolysaccharide/IL -1 induced...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Soluble IL-18 receptor complex: a new star in the firmament of rheumatoid arthritis diagnosis" pptx
... T, Matsunaga K, Sakazaki Y, Sawada M, Oda H, Takenaka S-I, Imaoka H, Kinoshita T, Honda S, Ida S, Fukuda T -A, Aizawa H: Soluble interleukin -18 receptor complex is a novel biomarker in rheumatoid ... with RA Clin Pharmacol Ther 2 010 , 87: 311 -3 21 Vanarsa K, Mohan C: Proteomics in rheumatology: the dawn of a new era F1000 Med Rep 2 010 , 2:87 Carrasco R, Barton A: Biomarkers of outcome in rheumatoid ... Arthritis Research & Therapy 2 011 , 13 :11 1 http://arthritis-research.com/content /13 /2 /11 1 endogenous IL -18 activity in the collagen-induced model of arthritis J Clin Invest 20 01, 10 8 :18 25 -18 32 10 Veenbergen...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt
... 5'TTCCTGAGGGCTCACTGATTAAC and 5'-GAAGGGGAGAGTCAGTTGTTGGAG (external to the ORF) or 5'AGACTGCGGAGATAAAACTGC and 5'-gataaaggtcatcagcctattga (internal to the ORF) PCR products were then cloned in pGEM-T Easy ... syncytin-Ory1 expression of day 12 rabbit placenta: (A) Schematic representation of a rabbit placenta (right) and haematoxylin and eosin staining of a day 12 placenta section (left) with the main layers ... 2003, 10 0 :13 013 -13 018 Page 10 of 11 (page number not for citation purposes) Retrovirology 2009, 6 :10 7 10 11 12 13 14 15 16 17 18 19 20 Blaise S, Ruggieri A, Dewannieux M, Cosset F-L, Heidmann T:...
Ngày tải lên: 12/08/2014, 23:22
Báo cáo y học: "Bench-to-bedside review: Circulating microparticles - a new player in sepsis" ppt
... A novel vascular redox pathway Crit Care Med 2004, 32: 818 -825 doi :10 . 11 86/cc92 31 Cite this article as: Meziani F, et al.: Circulating microparticles: a new player in sepsis? Critical Care 2 010 , ... 8:3346-3354 15 Dasgupta SK, Abdel-Monem H, Niravath P, Le A, Bellera RV, Langlois K, Nagata S, Rumbaut RE, Thiagarajan P: Lactadherin and clearance of platelet-derived microvesicles Blood 2009, 11 3 :13 32 -13 39 ... 2003, 10 9 :11 9 -12 4 11 Cohen Z, Gonzales RF, Davis-Gorman GF, Copeland JG, McDonagh PF: Thrombin activity and platelet microparticle formation are increased in type diabetic platelets: a potential...
Ngày tải lên: 13/08/2014, 21:21
fish, fishers, seals and tourists- economic consequences of creating a marine reserve in a multi-species, multi-activity context
... previous drafts 410 ´ BONCOEUR, ALBAN, GUYADER AND THEBAUD REFERENCES M.T Agardy [19 93], Accommodating Ecotourism in Multiple Use Planning of Coastal and Marine Protected Areas, Ocean Coastal Manage ... stock and using a global discrete-time logistic model, Lauck et al [19 98] have advocated marine reserves as a way of implementing the precautionary principle in fisheries management Also using a global ... Protected Area: Scuba Divers, Economics, Ecology and Management in Julian Rocks Aquatic Reserve, Australian Parks and Recreation 31, 29 35 J .A Dixon, et al [19 93], Meeting Ecological and Economic Goals:...
Ngày tải lên: 04/03/2015, 10:25
The Incompleteness Phenomenon A New Course in Mathematical Logic
Ngày tải lên: 08/06/2015, 17:27