create the second cell and add a plot

... fallen well below that level And, in fact, the figures show that postal savings did have at least a modest interest advantage from the mid-1930s until the early 1950s, and this advantage was at ... building) and loan associations than they were at banks, but they started growing rapidly a few years earlier, in 1929, and continued until the late 1930s Commercial bank failures, on the other hand, ... described in the 1979 article by O’Hara and Easley, as already noted 19 Aside from postal savings, this includes deposits at mutual savings banks, savings and loan associations (usually known as building,...

Ngày tải lên: 29/03/2014, 07:20

... AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA) AGCAGUAGCAAGGGGAUUUUUUCAAGGUAA(UUA) ... sequencea AGCAGUAGCAAGAGGAUUU(UUA) AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA ... AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGUAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUU AACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA PB2 PB2/6U PB2/85 PB2/34...

Ngày tải lên: 20/06/2014, 01:20

... Crypa, Cryptosporidium parvum; Plafa, Plasmodium falciparum; Playo, Plasmodium yoelii yoelii; Thean, Theileria annulata; Thepa, Theileria parva; Parte, Paramecium tetraurelia, Tetth, Tetrahymena ... Homsa;CYCE2 Homsa;CYCE1 Arath;CYCB1;1 Arath;CYCB3;1 Thaps (33377) Thaps (36441) Phatr;CYCA/B;1 Homsa;CYCF Arath;CYCA1;1 Arath;CYCA2;1 Arath;CYCA3;1 Ostta;CYCA Homsa;CYCA1 Homsa;CYCA2 Homsa;CYCB2 ... sequences are shown in bold Abbreviations: Arath, Arabidopsis thaliana; Homsa, Homo sapiens; Ostta, Ostreococcus tauri; Phatr, Phaeodactylum tricornutum; and Thaps, Thalassiosira pseudonana Huysman...

Ngày tải lên: 09/08/2014, 20:21

... repeat CT scan of the abdomen and pelvis revealed leakage into the abdominal cavity (Figure 6) Urgent re-exploration of the abdominal cavity revealed a moderate amount of contrast material and ... clinical and pathological features of the jejunum After the Figure Transmural necrotic tract through the intestinal wall and lymphoma Fecal content overlies the zone of necrosis and coats the tract ... All authors read and approved the final manuscript MD reviewed the literature and participated in writing the abstract, introduction, and discussion sections FB participated in writing the case...

Ngày tải lên: 11/08/2014, 00:22

... unclear pronunciation, their bad voice quality, lack of confidence all made it difficult for them to be understood Besides, the data from the study confirm the fact that the infrequent and inadequate ... Declaration I declare that this thesis is my own work and has not been submitted in any form for another degree or diploma at any university or other institution of tertiary education Information ... On the part of the second- year majors, for example, in order to be effective learners of English in general and effective speakers in particular, they need to improve their knowledge of the target...

Ngày tải lên: 07/09/2013, 13:02

... what a leaner has grasped The argument is that tests can serve positive, intrinsically motivating aims as they spur learners to master all of their abilities for a particular performance and then ... to explain the purpose, relevance and importance of the study, as well as to clarify any questions that the learners had 2.3 Data Analysis and Discussion of the Findings 2.3.1 Data Analysis 20 ... teachers and students can evaluate how well or badly the students have performed and students, as a result, can learn something from their presentations, namely, what they achieved and what they failed...

Ngày tải lên: 29/01/2014, 10:43

... plasminogen activator stimulates the Ras/ Extracellular signal-regulated kinase (ERK) signaling pathway and MCF-7 cell migration by a mechanism that requires focal adhesion kinase Src, and Shc Rapid ... GAPDH gene [20] GAPDH mRNA was utilized as a constant mRNA for control Statistical analysis The statistical analysis of the data was performed using the unpaired Student’s t-test, assuming a ... endothelial cell line and it is now evident that the endothelial cell plays a crucial role in angiogenesis [39] and that it might affect the growth and differentiation of neighboring cells [40] The...

Ngày tải lên: 21/02/2014, 01:21

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢ b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse 5¢-AAGGAAGGCTGGAAGAGT-3¢ Cell survival and apoptosis analysis In vivo interaction ... PP2500 and ANKHD1 variant In this study we focus on the biochemical and functional characterization of the novel VBARP-L and VBARP-S transcripts Bioinformatics analyses show that VBARP-L and VBARP-S...

Ngày tải lên: 07/03/2014, 21:20

... or patent, and they reviewed how easily and cheaply it could be massproduced Finally, they made a test commercial and ran it in several markets The cost of this next phase was always in the five ... out there are ready-andwilling buyers right now It’s a matter of finding them, and I’ll explain exactly how to that “All the Really Good Ideas Are Taken” That’s just crazy Anyone who says that ... really a shame that nothing works that way despite the slick brochures and teleseminars to the contrary, so suppress that internal caveman when he gets all hot and heavy after hearing such talk...

Ngày tải lên: 16/03/2014, 10:56

... interface is GGTACCG CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG Cell culture, ... 5¢ interface between cDNA and pEBTet is AAGCTT GAATTCTGCAGAT TCGA gccacc ATGCGGGA (polylinker in bold, Kozak motif in lower case, cDNA underlined); the 3¢ interface is ATTTCTAGA TCCAGCAC For pEBTetD ... GGTACC CCCCCGGA; the 3¢ interface is ATGCCTGC GGGGATCCAC TAGTAACGGC CGCC AGTGTG CTGGAATTCT GCAGATATCC ATCACAC TGGCGGCC The cDNA of eGFP corresponds to GenBank entry U57609 For pEBTet ⁄ eGFP, the...

Ngày tải lên: 23/03/2014, 09:21

... native language as a point of departure) Troyanovich advocates an audiolinguallystructured classroom based solely on the spoken word Valdes, Guadalupe, Paz Haro and Maria Paz Echevarriarza The ... filters, are aware of their audience (i.e., use reader-based prose), and concentrate (at least initially) on content rather than accuracy Krashen argues that concerns for grammar should only appear at ... of writing in the second language classroom It contains both “hands-on” material directly applicable to the language classroom and articles, which trace the historical and theoretical development...

Ngày tải lên: 24/03/2014, 19:20

... reaction was initiated by adding m glutamate, 10 mm MgCl2 and mm GTP and the intensity of light scattering was monitored for 15 at 37 °C Effect of TMAO on the GTPase activity of FtsZ A standard malachite ... 273, 669–676 22 Mandal AK, Samaddar S, Banerjee R, Lahiri S, Bhattacharyya A & Roy S (2003) Glutamate counteracts the denaturing effect of urea through its effect on the denatured state J Biol Chem ... entropically unfavorable and it becomes more unfavorable with increasing surface area of the protein Osmolytes may decrease the solvent-accessible surface area of proteins and the reduction in the...

Ngày tải lên: 30/03/2014, 16:20

... U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ... HIV1 and HCV in the same cell may greatly aggravate the malady Our TEM analysis showed HHV- 6A and HCV in the same cells, with extracellular HIV-1 particles budding or adjacent to the infected cells ... performed molecular work S.Z.S and D.R designed and conducted experiments, analyzed the data, and wrote the manuscript All of the authors have read and approved the final manuscript Acknowledgements...

Ngày tải lên: 18/06/2014, 18:20

... evaluation of Cell Cycle Analysis (FACs), Ymin/T0 and EC50 values (See METHODS) Additional Table S2 Available Karyotype data for Cell lines treated with GSK1070916 Additional Table S3 Among cell ... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, et al: AZD1152, a novel and selective aurora B kinase inhibitor, induces growth arrest, apoptosis, and...

Ngày tải lên: 18/06/2014, 22:20

... yeasts and Schwann cells coordinate cell growth and cell- cycle progression so differently? The lifestyles of yeasts and animal cells are crucially different As a unicellular organism, each yeast ... similar results which big mammalian cells have been observed to grow faster than small cells of the same type and at the same point of the cell cycle It thus seems likely that most mammalian cells ... standard deviation of cell volumes from one plate of cells Although a population of Schwann cells maintained a constant average cell size if passaged frequently (Figure 2), the cells decreased...

Ngày tải lên: 06/08/2014, 18:20

... (IEd-α2 and IEd-β2) These mice were bred in a barrier facility (John P Robarts Barrier Facility, London, Ontario, Canada) and maintained at a conventional animal housing facility (Animal Care and ... Biomedicals, Montreal, Quebec, Canada) was added to each well Cells were harvested onto glass fiber filters (Wallac, Turku, Finland) and radioactivity was determined using a Wallac 1450 Microbeta liquid ... immunosorbent assay, as described in Materials and method Data represents the average IFN-γ response ± SD of three mice hAG, human aggrecan amino acid from hAG 280–292, and the HBsAg L2 3A/ T28R peptide has...

Ngày tải lên: 09/08/2014, 01:21

... (RelA) and RelB [19] There are multiple pathways to activate NF-κB The two most common pathways are the canonical and the non-canonical pathways [20,21] In the canonical pathway, proceeding the ... leukemia Carcinogenesis 2005, 26:1382-1388 Watanabe M, Ohsugi T, Shoda M, Ishida T, Aizawa S, Maruyama-Nagai M, Utsunomiya A, Koga S, Yamada Y, Kamihira S, Okayama A, Kikuchi H, Uozumi K, Yamaguchi ... been established as a cellular target of Tax and an essential component in Tax-mediated NF-κB signaling in both canonical and non-canonical pathways Therefore, we reasoned that the specific targeting...

Ngày tải lên: 10/08/2014, 05:21

... and FC evaluated and treated the patient SG and MIF carried out PCR assays and cytogenetics MP reviewed the manuscript All authors read and approved the final manuscript Carulli et al Journal ... cyclin-D1-negative, bcl-1/JH-negative and t(11;14)-negative The most probable diagnosis was that of a simultaneous occurrence of a splenic MCL and a MZL, with the latter involving the bone marrow and ... Pisa, Italy Authors’ contributions GC evaluated the patient and wrote the manuscript AM, EC and VO carried out flow cytometry EMC, JB and SV were the pathologists who examined the histological specimens...

Ngày tải lên: 10/08/2014, 23:20