create a new user in phpmyadmin for database

... coffin, hiring a funeral Trang 118 band, inviting a sorcerer; selecting daughter-in-law and son-in-law of the dead; raisin chin; closing the dead’ eyes; dressing the dead; wearing new shoes; hanging ... Funeral rites for the new dead 2.2.1 Raising spirit of and washing the dead Raising spirit of the dead, knifing the window, alarming, notifying, bathing the dead with fragrant water, preparing ... groups in Vietnam; majority is the Muong people and the Tay Thai language in localities These are important data helping the dissertation author approach funeral rites in general and have comparative

Ngày tải lên: 18/05/2016, 07:42

... study and at the data acquisition followed by data preparation for the current analysis. RP participated at data acquisition and data preparation for the current analy-sis. TU participated in the ... as reference category Discussion Increasing age seems to be a barrier for forming an inten-tion, both among female and male teachers But only for male teachers actual participation in the coaching ... regarding working conditions, occupational history and self-rating scales With this questionnaire data on family background (having chil-dren, marital status) was obtained for reasons of adjust-ment

Ngày tải lên: 20/06/2014, 00:20

... 1.2 Trang 2Using this functional, Matsushita and Takahashi2,3 studied and investigated the followingmappings in Banach spaces A mapping S : C → E is relatively nonexpansive if the following properties ... sequences With an appropriate setting, we obtain the corresponding results due to Takahashi-Takahashi and Takahashi-Zembayashi Some of our results are established with weaker assumptions 1 Introduction ... Takahashi and W Takahashi17 and Takahashi and Zembayashi 19, we prove a strong convergence theorem for finding a common element of the fixed points set of a relatively nonexpansive mapping and

Ngày tải lên: 21/06/2014, 05:20

... well-defined In 2009, Kangtunyakarn and Suantai 9 introduced a new mapping, called K-mapping, for finding a common fixed point of a finite family of nonexpansive mappings For a finite family ... iteration process has only weak convergence, even in a Hilbert space setting In general for example, Reich2 showed that if E is a uniformly convex Banach space and has a Frehet differentiable ... distribution, and reproduction in any medium, provided the original work is properly cited We introduce a new general iterative method by using theK-mapping for finding a common fixed point of a finite family

Ngày tải lên: 21/06/2014, 11:20

... Trang 244 PCI JOURNALTrang 3March-April 1992 45Trang 446 PCI JOURNALTrang 5March-April 1992 47Trang 648 PCI JOURNALTrang 7March-April 1992 49Trang 850 PCI JOURNALTrang 9March-April 1992 51Trang ... PCI JOURNALTrang 11March-April 1992 53Trang 1254 PCI JOURNALTrang 13March-April 1992 55Trang 1456 PCI JOURNALTrang 15March-April 1992 57Trang 1658 PCI JOURNALTrang 17March-April 1992 59Trang 1860 ... 17March-April 1992 59Trang 1860 PCI JOURNALTrang 19March-April 1992 61Trang 2062 PCI JOURNALTrang 21March-April 1992 63Trang 2264 PCI JOURNALTrang 23March-April 1992 65

Ngày tải lên: 05/05/2018, 14:12

... Variables Available in page.tpl.php 182 Intercepting and Overriding Variables 184 Making New Variables Available 185 Using Multiple Templates 186 Dynamically Theming Page Elements 189 Creating ... 2007 Trang 4Production Coordinator Aparna Bhagat Shantanu Zagade Cover Designer Aparna Bhagat Trang 5About the AuthorRic Shreves is a partner in water & stone (www.waterandstone.com), a web ... 165 Extending Your PHPTemplate Theme 179 Variables Available in block.tpl.php 179 Variables Available in box.tpl.php 180 Variables Available in comment.tpl.php 181 Variables Available in node.tpl.php

Ngày tải lên: 20/03/2019, 11:52

... Total ground capacitance of the HV windings CHL Total inter-winding capacitance between HV-LV windings Ciw Inter-winding capacitance between HV-LV phase winding Ciw0 Inter-winding capacitance ... lea-kage inductance and/or winding capacitances would change Therefore, determination of the parameters from measurements is of great importance in maintenance and diagnostics Trang 16indica-For a ... determine ground and inter-winding capacitances from measurements  A feasible approach to identify winding series capacitance in transformer bulk In appearance, after introduction the state-of-the-art

Ngày tải lên: 28/01/2021, 21:55

... diploma thesis by Ing B Kaanová (Kaanová, 2012) This fact dramatically affects the results achieved, especially for Tab 3 Standard deviations calculated from a comparison of the spatial coordinates. ... comparing the coordinates of the spatial variations in Tab 4 for a comparison of the lengths Trang 8According to the size of the standard deviations in Tables 3 and 4, it can be argued that all ... mini prism, a separate reflective foil, and a new target with a reflective target plate and a mechanical collimator, were chosen for further testing The testing objective was to obtain standard

Ngày tải lên: 24/11/2022, 17:56

... with a particular interest for the caudal auricular artery (CAA) CCA, external carotid artery (ECA), CAA, superficial temporal artery (STA) and rostral auricular artery (RAA) lengths and calibers ... with saline in CAA (n=4), and with 70 ml scarlet eosin (EO) mixed with saline in STA (n=2) Stained ear and adjacent integuments were then evaluated for intensity and area of perfusion Auricular ... rostral facial area, without crossing the midline In combined STA/CAA injections, CAA staining territory was predominant on STA regarding ear perfusion (FIG5B) Harvested pedicled ear Mean weight

Ngày tải lên: 04/12/2022, 16:01

... possible (things outstanding are Trang 4Fig 10 A Mind Map by a company director, summarising the Brain Training and Mind Mapping Course The central image refers to the integration of the brain and the ... note-taking effectively you will INFORMATION FUNNELLED IN SPRAYED OUT Trang 3The Mind Map — A New Dimension in Note-TakingA Mind Map draws on all your mental skills: the Associative and Imagination ... and memory) and then branch out in an organised fashion around that image, using Key-Words and Key Images As you continue to build up the Mind Map, your brain creates an organised and integrated

Ngày tải lên: 09/08/2013, 11:51

... apparent Europe Asia Africa America Oceania Cross Europe Asia Africa America Oceania Cross Europe Asia Africa America Oceania Cross Europe Asia Africa America Oceania Cross Figures 6a-6d: Services ... (www.nccr-trade.org) For research and coding assistance, we thank Johanna Bötscher, Martina Castro, Kristina Hauser, Benjamin Hofmann, Theresa Kuhn, Salome Lang, Justin Leinaweaver, Julie Mandoyan, Martiño ... Rubal Maseda, Claudia Meier, Irina, Mirkina, Katharina Niedermayer, Livio Raccuia, Maria Rubi, and Kathrin Schwaller We are grateful for comments and suggestions to Richard Baldwin, Roberto Echandi,

Ngày tải lên: 02/06/2014, 09:22

... Trang 15Figure 6.1 Biases and cross-border inefficiencies and mispricingsTrang 21Figure 6.2 The reputable capital key and cross-border inefficienciesTrang 22Figure 6.3 The uses of reputable capital ... reputable capital key and cross-border inefficienciesTrang 22Figure 6.3 The uses of reputable capital

Ngày tải lên: 20/06/2014, 20:20

... Trang 1Figure 6.4 Waleed’s one-mile tower

Ngày tải lên: 20/06/2014, 20:20

... used for a system of the generalized nonlinear Schr ¨odinger equations, Regularized long waveRLW equations, Sine-Gordon equation, Klein-Gordon equation, Zakharov equations, Rosenau equation, ... conservative scheme is better than the nonconservative ones Zhang et al 1 point out that the nonconservative scheme may easily show nonlinear blow up In 2 Li and Vu-Quoc said “ in some areas, ... numerical experiments are shown 2 A Nonlinear-Implicit Conservative Scheme In this section, we propose a nonlinear-implicit conservative scheme for the initial-boundary value problem1.1–1.3 and

Ngày tải lên: 21/06/2014, 11:20

... used all samples of three famous iris databases, that is, CASIA-IrisV3, Bath, and Ubiris CASIA-IrisV3 includes three subsets which are labeled as CASIA-IrisV3-Interval, CASIA-IrisV3-Lamp, and CASIA-IrisV3-Twins ... of masking fragile bits For each user the proper rectangular calculated and features inside this rectangular are eliminated from iris code generation process For being rotation invariant, in this ... performance In [4], we explained how to use pointwise level set with area preserving capability for iris localization purposes We have also introduced a method for mapping the initial coordinates

Ngày tải lên: 21/06/2014, 22:20

... usually has low data security The value transformation algorithms transform the data value of the original signal with some kinds of transformation It has the potential of low computa-tional ... generating a binary sequence to control the bit-circulation functions for per-forming the successive data transformation on the input data Eight 8-bit data elements are regarded as a set and fed into ... become a critical and imperative issue in the mul-timedia data transmission applications In order to protect valuable data from undesirable readers or against illegal re-production and modifications,

Ngày tải lên: 23/06/2014, 01:20

... building spaces only Today’s A/C systems: • Maintain a healthy building environment o In commercial and new residential, A/C provides ventilation air to maintain indoor air quality o A/C maintains ... saturation line (as in the case of SHR = 0.5), standard DX A/C cannot meet latent load, and the RH will increase If humidity is maintained at 50% RH (Figure 2–3), standard DX A/C cannot maintain RH ... preheating the ambient air using an air-to-air heat exchanger (AAHX) The air comes into heat and mass exchange with the hot desiccant (in this example at 190°F) and carries the desorbed water vapor

Ngày tải lên: 27/06/2014, 14:20

... only those that take part in at least one k-clique To guarantee that all nodes are in at least one cluster, those that are not con-tained in at least one k-node cluster are added as Theorem 3 ... Katharina A Zweig - nina@ninasnet.de; Gergely Zahoránszky-Köhalmi* - gzahoranszky@gmail.com * Corresponding author Abstract Background: Hierarchical clustering methods like Ward's method have ... performsvery well In general, CCC is advantageous in the follow-ing cases: 1 if the given data set does not allow for a meaningful,real-valued similarity or dissimilarity relationship,defined for

Ngày tải lên: 12/08/2014, 17:20

... 5'-GCTGTTTTTAT-GCTAACAAGTCC and 5'-GATAAAGGTCATCAGC CT ATTGA for Env-Ory1 and 5'-CCTCTAAATGTCATCTTCAC-CAG and 5'-CTATTGGGA5'-CCTCTAAATGTCATCTTCAC-CAG5'-CCTCTAAATGTCATCTTCAC-CAGTTCTAGTC for Env-Ory2, The transcript ... 5'-TTCCTGAGGGCTCACTGATTAAC and GAAGGGGA-GAGTCAGTTGTTGGAG (external to the ORF) or 5'-AGACTGCGGAGATAAAACTGC and 5'-gataaaggtcat-cagcctattga (internal to the ORF) PCR products were then cloned in pGEM-T ... stained with haematoxylin and eosin or used for in situ hybridiza-tion A PCR-amplified 1135 bp syncytin-Ory1 fragment (primers: AGACTGCGGAGATAAAACTGC and 5'-GTGGACCGCGATTCCTAGTC) was cloned into

Ngày tải lên: 12/08/2014, 23:22

... total dam cost Well adapted risk analyses and new solutions for spillways may allow substantial savings to be made Thirty years ago, most dams were designed for a design flood with an annual ... the largest risk associated with gated dams, and jamming may be caused by mechanical or electrical problems, access, lack of operators, or wilful damage In the case of total jamming of gates, new ... redundancy of operating devices (including power supply) Incidents during heavy rainfall are not uncommon, and total jamming of gates has caused the failure of some large dams: this risk appears

Ngày tải lên: 13/08/2014, 22:21