counting null values in a column

Tài liệu Replacing Null Values in a Strongly Typed DataSet ppt

Tài liệu Replacing Null Values in a Strongly Typed DataSet ppt

... without null annotation CategoriesDS_AnnotatedNull ds = new CategoriesDS_AnnotatedNull( ); // Fill the Categories table within DataSet da.Fill(ds, CATEGORIES_TABLE); // Add a row with a null Description ... DataAdapter SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Categories", ConfigurationSettings.AppSettings["Sql_ConnectString"]); if (annotatedRadioButton.Checked) { // Create the typed DataSet without ... typed DataSet based on the Categories table in Northwind The user specifies whether the one based on the default or annotated schema file is used In either case, data is loaded into the DataSet A...

Ngày tải lên: 14/12/2013, 18:16

4 340 0
Tài liệu Use Wildcards and Ranges of Values in a SQL Query pdf

Tài liệu Use Wildcards and Ranges of Values in a SQL Query pdf

... System.Object, ByVal e As System.EventArgs) Handles MyBase.Load GenerateData() End Sub In the class module for the form, add the code in Listing 6.7 to create the GenerateData routine After creating the ... statement, this routine assigns it to the Text property of lblSQLString Then the string is used in a data adapter that was created to fill the dtResults data table Last, the data table is set as ... build the data adapter and fill the data table Dim odaResults As New OleDb.OleDbDataAdapter(Me.lblSQLString.Text, BuildCnnStr("(local)", "Northwind")) Dim dtResults As New DataTable() Try odaResults.Fill(dtResults)...

Ngày tải lên: 14/12/2013, 20:16

5 475 0
Báo cáo toán học: "COMPOSITION SUM IDENTITIES RELATED TO THE DISTRIBUTION OF COORDINATE VALUES IN A DISCRETE SIMPLEX" pptx

Báo cáo toán học: "COMPOSITION SUM IDENTITIES RELATED TO THE DISTRIBUTION OF COORDINATE VALUES IN A DISCRETE SIMPLEX" pptx

... into l disjoint groups The goal of labelled counting is to establish a relation between the cardinality of the sets of hands and the cardinality of the decks For example, when dealing with labelled ... us call a multiset M of integers sparse if M does not contain duplicates, and if |a − b| ≥ for all distinct a, b ∈ M Let us also say that a multiset M is 2-sparse if M does not contain duplicates, ... gauge-transformed into self-adjoint form, and as we saw above, spectral residue sequences are invariant with respect to gauge transformations Indeed, as we shall demonstrate shortly, the potential U(z) is uniquely...

Ngày tải lên: 07/08/2014, 06:20

14 349 0
Creating Custom Columns in a Windows Forms DataGrid

Creating Custom Columns in a Windows Forms DataGrid

... abstract DataGridColumnStyle class It defines the attributes, display format, and behavior of cells in a DataGrid column representing a Boolean value At runtime, each cell in the column hosts a ... DataGrid display column with the data column An exception will be thrown if duplicate mapping names are used The DataGridTextBoxColumn class inherits from the abstract DataGridColumnStyle class ... to the DataGrid The MappingName property of the DataGridTableStyle is set to the DataSource The MappingName of each DataGridColumnStyle object must be associated with the name of a DataColumn...

Ngày tải lên: 20/10/2013, 12:15

4 421 0
Tài liệu Counting Records in a DataReader ppt

Tài liệu Counting Records in a DataReader ppt

... The DataReader provides forward-only, read-only access to a stream of rows from a data source It is optimized for performance by reading data directly from a connection to a data source As a result, ... backwards in DataReader so when iterating, you must process data at the same time This technique provides the only accurate count of records in the DataReader A second technique demonstrated in ... information about output parameters, see Recipe 2.9 The HasRows( ) method of the DataReader was introduced in Version 1.1 of the NET Framework It returns a Boolean value indicating whether the DataReader...

Ngày tải lên: 24/12/2013, 05:15

4 376 0
Tài liệu Determining the Length of Columns in a SQL Server Table doc

Tài liệu Determining the Length of Columns in a SQL Server Table doc

... // Add table mappings da.TableMappings.Add("Table", "Orders"); da.TableMappings.Add("Table1", "Order Details"); // Create the DataSet DataSet ds = new DataSet( ); // Fill the schema and data da.FillSchema(ds, ... Books Online The GetSchemaTable( ) method of the DataReader also returns all column lengths The method returns a DataTable containing column metadata for a DataReader, where the ColumnSize column ... da.FillSchema(ds, SchemaType.Mapped); da.Fill(ds); // Iterate over the table collection in the DataSet foreach(DataTable dt in ds.Tables) { schemaInfo.Append("TABLE: " + dt.TableName + Environment.NewLine);...

Ngày tải lên: 24/12/2013, 05:15

4 459 0
Tiểu luận phương pháp nghiên cứu khoa học: Service personal values and customer loyalty A study of banking services in a transitio nal economy

Tiểu luận phương pháp nghiên cứu khoa học: Service personal values and customer loyalty A study of banking services in a transitio nal economy

... et al., 2007; Ples hco and Baqer, 2008; Shankar et al., 2003; Bigne´ et al., 2008; Han et al., 2008; Martin-Consuegra et al., 2007; Henning-Thurau et al., 2002; Wong and Zhou, 2006; Story and ... người tiêu dung  Parasuraman et al., 1988; Cronin and Taylor, 1992; Cronin et al., 1997; Lages and Fernandes, 2005; Cheng et al., 2008; Spreng and Singh, 1983; Oliver, 1980: th a mãn  Bowen Chen, ...  Anana Nique, 2007; Schiffman Kanuk (1997); Kamakura Novak, 1992; Lages Fernandes , 2005; Liu et al., 2009: giá trị cá nhân NHÓM 12 – ĐÊM – KH A 22 Trang TIỂU LUẬN PHƯƠNG PHÁP NGHIÊN CỨU KHOA...

Ngày tải lên: 05/06/2014, 12:45

21 1,3K 3
báo cáo hóa học: " Astrogliosis is delayed in type 1 interleukin-1 receptor-null mice following a penetrating brain injury" pptx

báo cáo hóa học: " Astrogliosis is delayed in type 1 interleukin-1 receptor-null mice following a penetrating brain injury" pptx

... penetrating brain injury The increase vs WT mice afteris delayed in IL-1R1 -null The increase in GFAP protein is delayed in IL-1R 1null mutant mice vs WT mice after a penetrating brain injury GFAP ... age IL-1R1 -null mice were originally provided by Amgen Inc (Seattle, WA) All mice were bred and maintained at the Hershey Medical Center by the Department of Comparative Medicine, an AAALAC accredited ... Research Penetrating brain injury and micro-injection of IL-1 Surgery on adult male mice was performed under xylazine/ketamine anesthesia (2mg xylazine and 15 mg ketamine/kg) Once the animal failed...

Ngày tải lên: 19/06/2014, 22:20

11 402 0
báo cáo hóa học:" Single column locking plate fixation is inadequate in two column acetabular fractures. A biomechanical analysis" doc

báo cáo hóa học:" Single column locking plate fixation is inadequate in two column acetabular fractures. A biomechanical analysis" doc

... fracture line and generating shear Differences in stiffness of the various plating constructs were then analyzed using an ANOVA test Assuming a stiffness standard deviation of 0.25 N/mm and a ... scheme was graphed Visualizing the displacements in this way allows one to understand how the fracture displaced under load, either perpendicular to the fracture line and creating a gap, or parallel ... our hypothesis that a locking plate applied to the anterior column of a transverse acetabular fracture will result in a construct that is more rigid than a nonlocking plate and that this construct...

Ngày tải lên: 20/06/2014, 04:20

6 376 0
Báo cáo hóa học: " EXISTENCE OF ZEROS FOR OPERATORS TAKING THEIR VALUES IN THE DUAL OF A BANACH SPACE" potx

Báo cáo hóa học: " EXISTENCE OF ZEROS FOR OPERATORS TAKING THEIR VALUES IN THE DUAL OF A BANACH SPACE" potx

... point out an interesting alternative coming from Theorem The spaces C (X,Y ) and C (X) that will appear are considered with the sup-norm We recall that a subset D of a topological space S is a ... Theorem can be improved assuming that A is a compact operator (i.e., continuous and with relatively compact range) Biagio Ricceri 193 Remark 10 Note that Theorem can be compared with the classical ... Convex Anal (1995), no 1-2, 287–290 J Saint Raymond, Multivalued contractions, Set-Valued Anal (1994), no 4, 559–571 Biagio Ricceri: Department of Mathematics, University of Catania, 95125 Catania,...

Ngày tải lên: 23/06/2014, 00:20

8 315 0
Báo cáo toán học: "Counting subwords in a partition of a set" potx

Báo cáo toán học: "Counting subwords in a partition of a set" potx

... that π (j) is a word over the alphabet [a − 2], for all j Therefore Aa = Aa−1 + xAa−1 A a 1 , − xAa−1 which implies that a 2 a 2 xAa−1 Aa−1 − m−1 xℓ−2 (1 − y) Aa−1 − m−1 xℓ−1 (1 − y) Aa = Aa−1 ... partitions For instance, Chen et al [2], Klazar [7], Sagan [12], Mansour and Severini [9], and Jel´ inek and Mansour [6] have studied pattern avoiding partitions In [8], Mansour and Munagi studied ... τ in a (a + 1) Clearly, A a = Aa − m−1 xℓ−2 (1 − y) Note that each word π over the alphabet [a − 1] either does not contain a − or may be expressed as π (1) (a − 1)π (2) (a − 1) · · · π (s) (a...

Ngày tải lên: 08/08/2014, 11:20

21 167 0
Báo cáo khoa hoc:" A sampling method for estimating the accuracy of predicted breeding values in genetic evaluation" potx

Báo cáo khoa hoc:" A sampling method for estimating the accuracy of predicted breeding values in genetic evaluation" potx

... about 300 000 animals included in the evaluation, which corresponds to seven beef breeds currently evaluated in France (Blonde dAquitaine, Salers, Aubrac, Gasconne, Parthenaise, Maine-Anjou and ... then applied to all the Salers breed animals involved in the French on-farm evaluation of 2000 MATERIALS AND METHODS 2.1 Models Consider a Gaussian mixed linear model with one random factor and a ... merits of animals or groups of animals can be estimated by looking at PEV [5,16] or at CD [17,18] of the corresponding contrast This contrast may be seen as a linear combination of breeding values...

Ngày tải lên: 09/08/2014, 18:21

14 296 0
Báo cáo y học: "Baseline cerebral oximetry values in cardiac and vascular surgery patients: a prospective observational study" doc

Báo cáo y học: "Baseline cerebral oximetry values in cardiac and vascular surgery patients: a prospective observational study" doc

... oxygenation monitoring in clinical practice, more data are needed to establish baseline values and identify factors influencing INVOS measurement in different patient populations Relevant data have ... left-sided baseline INVOS values Regression was done on 92 cases (8 cases contained missing values) , and showed that LVEF and baseline right-side baseline INVOS values are independent, significant predictors ... Demographic data, risk factors and baseline preoperative INVOS values are presented in Table Patients undergoing carotid surgery were significantly older, and had higher baseline INVOS values and...

Ngày tải lên: 10/08/2014, 09:22

7 290 0
Báo cáo y học: " Mucocele-like tumor and columnar cell hyperplasia of the breast occurring in a morphologic continuum" pptx

Báo cáo y học: " Mucocele-like tumor and columnar cell hyperplasia of the breast occurring in a morphologic continuum" pptx

... proliferations, including intraductal carcinoma, invasive carcinoma, atypical ductal hyperplasia and hyperplasia of the usual type [2-4] Most invasive carcinomas that arise in this setting are of ... observations suggest an association, perhaps in a nonobligate precursor role, between flat epithelial atypia and lobular neoplasia, tubular carcinoma and low-grade intraductal carcinoma [5-7] ... dilated spaces were lined by columnar cells, suggesting that the columnar cell lesions were simulating an MLT, as indicated by the author's caption "Columnar cell hyperplasia with intraluminal...

Ngày tải lên: 11/08/2014, 23:21

4 250 0
báo cáo khoa học: " A strong constitutive ethylene-response phenotype conferred on Arabidopsis plants containing null mutations in the ethylene receptors ETR1 and ERS1" ppsx

báo cáo khoa học: " A strong constitutive ethylene-response phenotype conferred on Arabidopsis plants containing null mutations in the ethylene receptors ETR1 and ERS1" ppsx

... ERS1 (Fig 1A) Sequence at the T-DNA junction with ERS1 was ATACTATTTTAAGAACCACaatgagtaaata(taaatggcgacatgtccggg), with capitals indicating ERS1 sequence and parentheses indicating T-DNA left border ... primer (5'-CACAACCGCGCAAGAGACTTTAGCA ATAGT-3') The etr1-9 mutant was identified by a PCRbased method using an ETR1-specific primer (5'-GCGGTTGTTAAGAAATTACCCATCACACT-3') and the same TDNA left border ... primers designed to anneal at the 3' end of an ERS1 cDNA clone (5'-ACTAGTGACTGTCACTGAGAA-3') or an ETR1 cDNA clone (5'-ATCCAAATGTTACCCTCCATCAGATTCAC-3') Radio-labeled probes were made and stripped between...

Ngày tải lên: 12/08/2014, 05:20

15 394 0
A representation for characteristic functionals of stable random measures with values in sazonov spaces

A representation for characteristic functionals of stable random measures with values in sazonov spaces

... This characterization, on any real separable Hilbert space, was first obtained by Kulbes (1973) Two X -valued α-stable random vectors X and Y are jointly SαS if and only if every linear combination ... random measures 37 A (.) It follows by a classical argument that {Φ (A) , A ∈ B(Rk )} induces an X - valued random measure on B(Rk ) It is plain to verify that Φ (A) is SαS Indeed, A (t) is real and ... Ledoux, and M Talagrand, Probability in Banach spaces, Berlin- HeidelbergNew York, 1991 [5] W Linde, Infinitely divisible and stable measures on Banach spaces, TeubnerTexte zur Mathematik, Band 58,...

Ngày tải lên: 14/11/2015, 08:03

13 307 0
Multithreaded Programming in a Microsoft  Win32* Environment

Multithreaded Programming in a Microsoft Win32* Environment

... doing something, the other threads can handle the user inputs and perform the tasks For example, if a user wants to cancel bringing in a large amount of data from a web page, a single threaded ... running at a higher priority can immediately react and cancel the operation When Not to Use Threads… Using multiple threads in an application does not guarantee any kind of a performance gain ... constantly interacting with the program, are independent activities The performance of an application can be improved by creating a separate thread for performing each of these activities rather...

Ngày tải lên: 12/09/2012, 14:40

14 796 1
travel in a group

travel in a group

Ngày tải lên: 04/10/2012, 10:25

1 1,1K 1
Báo cáo y học: "Emergency intraosseous access in a helicopter emergency medical service: a retrospective study"

Báo cáo y học: "Emergency intraosseous access in a helicopter emergency medical service: a retrospective study"

... and coordination, and in drafting the manuscript BEH participated in the design of the study and the statistical analysis, and participated in drafting the manuscript BHV participated in the design ... HEMS training programme, intraosseous training was given using manual needles, Bone Injection Guns, and EZ-IO® on both manikins and cadavers All HEMS physicians have used the technique on patients ... study, and the drafting of the manuscript and tables and figures All authors have read and approved the final manuscript Competing interests The authors declare that they have no competing interests...

Ngày tải lên: 25/10/2012, 10:02

5 563 0
w