core competencies of a manager

báo cáo sinh học:" Managerial competencies of hospital managers in South Africa: a survey of managers in the public and private sectors" docx

báo cáo sinh học:" Managerial competencies of hospital managers in South Africa: a survey of managers in the public and private sectors" docx

... item scales, and parametric analysis of variance (ANOVA) for responses that were summed to create a factor. All analyses were conducted at a 95% level of certainty and allowing for a margin of error of ... ultimate score that each manager received for each of the seven factors was calcu- lated from the mean of the summed items for that varia- ble. This allows one to treat the data as interval data measuring ... Central Page 1 of 7 (page number not for citation purposes) Human Resources for Health Open Access Research Managerial competencies of hospital managers in South Africa: a survey of managers...

Ngày tải lên: 18/06/2014, 17:20

7 506 0
Báo cáo khoa học: Structure of the core oligosaccharide of a rough-type lipopolysaccharide of Pseudomonas syringae pv. phaseolicola docx

Báo cáo khoa học: Structure of the core oligosaccharide of a rough-type lipopolysaccharide of Pseudomonas syringae pv. phaseolicola docx

... mild-acid hydrolysis and an oligosaccharide mixture (OS HOAc ) w as isolated by gel-permeation chromatograp hy on Sephadex G-50. Sugar analysis of OS HOAc by GLC of the acetylated alditols revealed ... Y .A. & K rohn, K. (1996) Immunochemic al characterization of O polysaccharid es compo- sing the a- D -rhamnose backbone of lipopolysaccharide of Pseu- domonas s yringae and classification of ... Mild acid degradation of the LPS gave the major glycoform 1 c ore octasaccharide and a minor trun- cated glycoform 2 core heptasaccharide, which resulted from the cleavage of the terminal Kdo residues....

Ngày tải lên: 23/03/2014, 13:20

10 326 0
Báo cáo toán học: " Metabolite proving fungal cleavage of the aromatic core part of a fluoroquinolone antibiotic" pdf

Báo cáo toán học: " Metabolite proving fungal cleavage of the aromatic core part of a fluoroquinolone antibiotic" pdf

... Dalhoff and Bergan (1998). Another major mechanism of FQ inactivation is N-4’-acetylation, in case of enrofloxacin following N-4’- deethylation, as catalyzed by the Zygomycete Mucor ramannianus ... the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Metabolite proving fungal cleavage of the aromatic core part of a fluoroquinolone ... provided all interpretations of the chemical raw data. All authors read and approved the final manuscript. Acknowledgements Part of this work was presented at the 111th Annual General Meeting of...

Ngày tải lên: 20/06/2014, 21:20

23 296 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... because of the absence of the catalytic subunit ISP (Table 1). Figure 3A shows that a band of approximately 500 kDa was also found in this mutant strain when the mitochondrial membranes were ana- lyzed ... deletion in Saccharomyces cerevisiae. Nucleic Acids Res 21 , 3329–3330. 45 Ito H, Fukuda Y, Murata K & Kimura A (1983) Transformation of intact yeast cells treated with alkali cations. J Bacteriol ... but also in other organisms, such as Neurospora crassa [13], mammals [11] and plants [14]. A higher-order organization of the respiratory chain complexes was first proposed for bacterial respiratory...

Ngày tải lên: 18/02/2014, 08:20

15 641 0
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

... Lipo-oligo- saccharide of Campylobacter lari type strain ATCC 35221. Structure of the liberated oligosaccharide and an associated extracellular polysaccharide. Carbohydr. Res. 279, 245–264. 1766 A. D. Cox et al.(Eur. ... revealed glucitol, galactitol, glucosaminitol and L -glycero- D -manno-heptitol in approximately equimolar ratios. Sugar analysis of the LPS-derived alditol acetates from the galE mutant of strain ... O-deacylated lipid A (Lipid A- OH) is as indicated. Lipid A- OH consists of two glucosamine residues each bearing an N-linked 3-OH C 14:0 fatty acid and a phosphate group. Variation in lipid A- OH...

Ngày tải lên: 08/03/2014, 02:20

8 361 1
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

... immunoprecipi- tated with antisera directed against P48 and TF, analyzed on SDS/ PAGE and visualized with a PhosphorImager. (B) Quantification of data presented in panel (A) , after correction for translation ... a- helical core region as indicated. The leader peptidase cleavage site is depicted with an arrow. Table 1. Bacterial strains and plasmids used in this study. Ts, temperature sensitive. Cam r and Amp r , ... directed against SecA, indicating that it is a complex of the radiolabeled (G-10L)94PhoE and SecA (Fig. 4B, lane 1). In addition, cross-linking adducts of  220 kDa and  40 kDa were also immunoprecipitated from...

Ngày tải lên: 08/03/2014, 09:20

8 548 0
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... 5Â-GGCGGATCCAAGCCAGTGGTTGTTAAT AC-3Â and 5Â-GCCTCGAGAATCAAGTGTCCCTGCACC T-3Â (LIN-54-DN); 5Â-GCGGATCCGAGGTGGTGCCAG CTGAG-3Â,5Â-GCTCTAGAGAATGGAAGCCGTGCCT G-3Â,5Â-GCTCTAGATTGGCAGATGCAGCTGAAGTA- 3Â and...

Ngày tải lên: 23/03/2014, 04:20

14 457 0
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

... plasmid. The gene was amplified from this plasmid by PCR using for- ward primer 5 Â-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3Â and reverse primer 5Â-ACT- TATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3Â. ... cDNA for cB using forward primer 5Â-ACTTATACTACT CATATGGGGAAGATCACTTTTT ACG-3Â and reverse primer 5Â-ACTTATACTATC CTCG AGATAAAAATCCATCACCCG-3Â, and digested this with restriction enzymes NdeI and ... chromatography was performed on a SMART chromatographic workstation (Pharmacia, GE Healthcare Biosciences AB, Uppsala, Sweden), using an analytical Superdex-200 column (Pharmacia) (bed volume approximately...

Ngày tải lên: 23/03/2014, 04:21

13 435 0
báo cáo hóa học: " Validation of a core outcome measure for palliative care in Africa: the APCA African Palliative Outcome Scale" pptx

báo cáo hóa học: " Validation of a core outcome measure for palliative care in Africa: the APCA African Palliative Outcome Scale" pptx

... management in sub-Saharan Africa: How much palliative care is needed?. AIDS Care 2007, 19(10):1304-1306. 13. Namisango E, Katabira E, Karamagi C, Baguma P: Validation of the Missoula-Vitas Quality -of- Life ... RESEARC H Open Access Validation of a core outcome measure for palliative care in Africa: the APCA African Palliative Outcome Scale Richard Harding 1* , Lucy Selman 1 , Godfrey Agupio 2 , Natalya ... Hospice Africa Uganda and the Hospice Palliative Care Association of South Africa. The APCA African POS The APCA African POS contains 10 items, addressing the physical and psychological symptoms,...

Ngày tải lên: 18/06/2014, 19:20

9 479 0
báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx

báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx

... Germany), a qualitative data management soft- ware [58], will be used to manage and analyze all quali- tative data. Quantitative analysis All tests will be two-sided and performed at significance level ... International Review of Psychiatry 1998, 10:47-50. 26. Guarnaccia PJ: Multicultural experiences of family caregiving: a study of African American, European American, and Hispanic American Families. New ... next steps and future plans. Data analysis Quantitative data entry and analysis will utilize SAS ver- sion 9.1.3 (SAS Institute, Inc., Cary, NC, USA). ATLAS. ti (ATLAS.ti S cientific Software Develo...

Ngày tải lên: 10/08/2014, 11:20

12 431 0
Báo cáo y học: " Research Transperineal prostate biopsy: analysis of a uniform core sampling pattern that yields data on tumor volume limits in negative biopsies" pdf

Báo cáo y học: " Research Transperineal prostate biopsy: analysis of a uniform core sampling pattern that yields data on tumor volume limits in negative biopsies" pdf

... point core in terms of a tumor radius, D T /2. The PoD is calculated from the ratio of that part of the core& apos;s detection area (2 A 1 + A sec ) that actually overlaps with the quadrant area ... biopsy. An analytic approach to systematic transperineal biopsy is presented. It assumes, for example, a suitable brachytherapy template and ultrasound guidance are used to deploy a uniform grid of ... [27- 29]. Conclusions Each feature of this transperineal biopsy approach the use of evenly spaced parallel cores, and sampling on one side of the midline initially offers advantages for improving Kepner and Kepner...

Ngày tải lên: 13/08/2014, 16:20

13 255 0
Báo cáo y học: "Reducing mortality in severe sepsis with the implementation of a core 6-hour bundle: results from the Portuguese community-acquired sepsis study (SACiUCI study)" pps

Báo cáo y học: "Reducing mortality in severe sepsis with the implementation of a core 6-hour bundle: results from the Portuguese community-acquired sepsis study (SACiUCI study)" pps

... such as the management of ST elevation acute myocardial infarction or the management of stroke [19,20]. In fact, a recent study on the impact of a national edu- cational program on the process of ... São Sebastião, Santa Maria da Feira); Paula Castelões (Unidade de Cuidados Intensivos, Centro Hospitalar de Vila Nova de Gaia); Teresa Cardoso (Unidade de Cuidados Intensi- vos Polivalente, ... design and acquisition of data and/or analysis and interpretation of data, as well as in the drafting, revising and final approval of the version to be published. Acknowledgements We are indebted...

Ngày tải lên: 13/08/2014, 20:22

11 353 0
A MANAGER’S GUIDE TO THE DESIGN AND CONDUCT OF CLINICAL TRIALS - PART 1 ppsx

A MANAGER’S GUIDE TO THE DESIGN AND CONDUCT OF CLINICAL TRIALS - PART 1 ppsx

... Technical Document 241 Data Management 241 Data Entry and Data Management 242 Small-Scale Clinical Studies 242 Clinical Database Managers 242 Data Analysis 243 Utilities 244 Sample Size Determination ... Information 187 15 Data Analysis 189 Report Coverage 189 Understanding Data 190 Categories 190 Metric Data 192 Statistical Analysis 194 Categorical Data 196 Ordinal Data 197 Metric Data 198 An Example ... carry a couple of aspirin with me in the car because I’ve read that taking an aspirin during or just after a heart attack could save my life. But if I were already taking an anticoagu- lant, an...

Ngày tải lên: 14/08/2014, 07:20

26 515 2
w