... mild-acid hydrolysis and an oligosaccharide mixture (OS HOAc ) w as isolated by gel-permeation chromatograp hy on Sephadex G-50. Sugar analysis of OS HOAc by GLC of the acetylated alditols revealed ... Y .A. & K rohn, K. (1996) Immunochemic al characterization of O polysaccharid es compo- sing the a- D -rhamnose backbone of lipopolysaccharide of Pseu- domonas s yringae and classification of ... Mild acid degradation of the LPS gave the major glycoform 1 c ore octasaccharide and a minor trun- cated glycoform 2 core heptasaccharide, which resulted from the cleavage of the terminal Kdo residues....
Ngày tải lên: 23/03/2014, 13:20
Ngày tải lên: 20/06/2014, 21:20
managerial competencies of middle-level managers at viglacera corporation
Ngày tải lên: 23/08/2014, 02:01
báo cáo sinh học:" Managerial competencies of hospital managers in South Africa: a survey of managers in the public and private sectors" docx
... item scales, and parametric analysis of variance (ANOVA) for responses that were summed to create a factor. All analyses were conducted at a 95% level of certainty and allowing for a margin of error of ... ultimate score that each manager received for each of the seven factors was calcu- lated from the mean of the summed items for that varia- ble. This allows one to treat the data as interval data measuring ... Central Page 1 of 7 (page number not for citation purposes) Human Resources for Health Open Access Research Managerial competencies of hospital managers in South Africa: a survey of managers...
Ngày tải lên: 18/06/2014, 17:20
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
Ngày tải lên: 06/09/2013, 05:48
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... because of the absence of the catalytic subunit ISP (Table 1). Figure 3A shows that a band of approximately 500 kDa was also found in this mutant strain when the mitochondrial membranes were ana- lyzed ... deletion in Saccharomyces cerevisiae. Nucleic Acids Res 21 , 3329–3330. 45 Ito H, Fukuda Y, Murata K & Kimura A (1983) Transformation of intact yeast cells treated with alkali cations. J Bacteriol ... but also in other organisms, such as Neurospora crassa [13], mammals [11] and plants [14]. A higher-order organization of the respiratory chain complexes was first proposed for bacterial respiratory...
Ngày tải lên: 18/02/2014, 08:20
Mobilizing Climate Finance - A Paper prepared at the request of G20 Finance Ministers potx
... This assumes, in addition, expanded regional initiatives in the U.S. and Canada and the adoption of national mitigation targets in Japan, Australia and New Zealand, resulting in 9 percent abatement. ... raise money for climate finance. These include most prominently a broad-based Financial Transactions Tax (FTT)—levied on the value of a wide range of financial transactions—and a Financial Activities ... Fast Start Finance for adaptation and mitigation activities in developing countries. They comprise the 27 EU member states, Australia, Canada, Iceland, Japan, New Zealand, Norway, Switzerland...
Ngày tải lên: 06/03/2014, 08:21
Components of Software Development Risk: How to Address Them? A Project Manager Survey ppt
... proponents of software risk management, information about the impact of software risk management has been sparse and anecdotal. There are only a few empirical studies about the commonality and type of software ... identification of risks that are often organizationally sensitive. It demands more courage to air such risks if organizationally accepted risk management procedures are not available. Interestingly, managers ... resource usage and deadline effect. The other items loading to this factor are: evaluation of performance require- ments, managing project complexity, and estimation of hardware and software capabilities....
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx
... Lipo-oligo- saccharide of Campylobacter lari type strain ATCC 35221. Structure of the liberated oligosaccharide and an associated extracellular polysaccharide. Carbohydr. Res. 279, 245–264. 1766 A. D. Cox et al.(Eur. ... revealed glucitol, galactitol, glucosaminitol and L -glycero- D -manno-heptitol in approximately equimolar ratios. Sugar analysis of the LPS-derived alditol acetates from the galE mutant of strain ... O-deacylated lipid A (Lipid A- OH) is as indicated. Lipid A- OH consists of two glucosamine residues each bearing an N-linked 3-OH C 14:0 fatty acid and a phosphate group. Variation in lipid A- OH...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
... immunoprecipi- tated with antisera directed against P48 and TF, analyzed on SDS/ PAGE and visualized with a PhosphorImager. (B) Quantification of data presented in panel (A) , after correction for translation ... a- helical core region as indicated. The leader peptidase cleavage site is depicted with an arrow. Table 1. Bacterial strains and plasmids used in this study. Ts, temperature sensitive. Cam r and Amp r , ... directed against SecA, indicating that it is a complex of the radiolabeled (G-10L)94PhoE and SecA (Fig. 4B, lane 1). In addition, cross-linking adducts of 220 kDa and 40 kDa were also immunoprecipitated from...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt
... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... 5Â-GGCGGATCCAAGCCAGTGGTTGTTAAT AC-3Â and 5Â-GCCTCGAGAATCAAGTGTCCCTGCACC T-3Â (LIN-54-DN); 5Â-GCGGATCCGAGGTGGTGCCAG CTGAG-3Â,5Â-GCTCTAGAGAATGGAAGCCGTGCCT G-3Â,5Â-GCTCTAGATTGGCAGATGCAGCTGAAGTA- 3Â and...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
... plasmid. The gene was amplified from this plasmid by PCR using for- ward primer 5 Â-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3Â and reverse primer 5Â-ACT- TATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3Â. ... cDNA for cB using forward primer 5Â-ACTTATACTACT CATATGGGGAAGATCACTTTTT ACG-3Â and reverse primer 5Â-ACTTATACTATC CTCG AGATAAAAATCCATCACCCG-3Â, and digested this with restriction enzymes NdeI and ... chromatography was performed on a SMART chromatographic workstation (Pharmacia, GE Healthcare Biosciences AB, Uppsala, Sweden), using an analytical Superdex-200 column (Pharmacia) (bed volume approximately...
Ngày tải lên: 23/03/2014, 04:21
A SURVEY OF BEHAVIORAL FINANCE° pot
... likelihood that a data set was generated by a particular model, people often fail to take the size of the sample into account: after all, a small sample can be just as representative as a large one. ... the only market participants trying to take advantage of noise traders: firm managers also play this game. If a manager believes that investors are overvaluing his firm’s shares, he can benefit ... tested against behavioral alternatives. Empirical studies of the behavior of individual stocks have unearthed a set of facts which is altogether more frustrating for the rational paradigm. Many of...
Ngày tải lên: 29/03/2014, 18:20
báo cáo hóa học: " Validation of a core outcome measure for palliative care in Africa: the APCA African Palliative Outcome Scale" pptx
... management in sub-Saharan Africa: How much palliative care is needed?. AIDS Care 2007, 19(10):1304-1306. 13. Namisango E, Katabira E, Karamagi C, Baguma P: Validation of the Missoula-Vitas Quality -of- Life ... RESEARC H Open Access Validation of a core outcome measure for palliative care in Africa: the APCA African Palliative Outcome Scale Richard Harding 1* , Lucy Selman 1 , Godfrey Agupio 2 , Natalya ... Hospice Africa Uganda and the Hospice Palliative Care Association of South Africa. The APCA African POS The APCA African POS contains 10 items, addressing the physical and psychological symptoms,...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo y học: ": Combined analysis reveals a core set of cycling genes" pdf
Ngày tải lên: 14/08/2014, 08:20
diary of a very bad year - anonymous hedge fund manager, n
Ngày tải lên: 04/11/2014, 10:55