... skills training for farmers and creation and packaging of information in local languages In Kenya, Agricultural Information Resource Centre (AIRC) of the Ministry of Agriculture Livestock and Fisheries ... local agriculture players as having reiterated that “Kenya still has a long and winding road to travel before it can tap the vast potential of the sector” In Kenya, majority of the people are ... Catholic Church at Kangaru and the one run by the Anglican Church of Kenya (ACK) at Macumo in Embu are typical examples of semi-private enterprises that help in advancing agricultural innovations
Ngày tải lên: 02/02/2020, 11:25
... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... considered the same parameters defined in Tables 1 and 2 in Software RETScreen International Clean Energy Project Analysis in order to make an analysis of economic and financial viability of wind energy ... evaluation and availability of wind resources in the macro defined location for the installation of central power generation, Caldas da Rainha, Portugal The assessment of wind resources and availability
Ngày tải lên: 05/09/2013, 14:59
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx
... Correspondence: baak@hanyang. ac.kr 3 Department of Mathematics, Research Institute for Natural Sciences, Hanyang University, Seoul 133-791, Korea Full list of author information is available at the end of ... groups are Banach spaces In 1978, Rassias [3] proved a generalization of Hyers’ theorem for additive mappings Furthermore, in 1994, a generalization of the Rassias’ theorem was obtained by Găvruta ... Trang 1R E S E A R C H Open AccessA fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces Hassan Azadi Kenary1, Sun Young Jang2and Choonkil Park3*
Ngày tải lên: 20/06/2014, 22:20
báo cáo hóa học:" Research Article Iterative Methods for Variational Inequalities over the Intersection of the Fixed Points Set of a Nonexpansive Semigroup in Banach Spaces" pot
... the Intersection of the Fixed Points Set of a Nonexpansive Semigroup in Banach Spaces Issa Mohamadi Department of Mathematics, Islamic Azad University, Sanandaj Branch, Sanandaj 418, Kurdistan, ... Mathematical Analysis and Applications, vol 338, no 1, pp 152–161, 2008 12 W Takahashi, Nonlinear Functional Analysis: Fixed Point Theory and Its Applications, Yokohama Publishers, Yokohama, Japan, ... Parallel Algorithm for Feasibility and Optimization,... “Approximation methods for common fixed points of nonexpansive mappings in e Hilbert spaces,” Journal of Mathematical Analysis and
Ngày tải lên: 21/06/2014, 11:20
Báo cáo hóa học: "Improving global influenza surveillance: trends of A(H5N1) virus in Africa and Asia" doc
... genetic analysis and data share) in avian influenza A(H5N1) surveillance Second, analysis of national surveillance trends revealed that genetic analysis of influenza viruses occurred in many cases as ... methodologies and regulations Findings The recent outbreaks of highly pathogenic avian influenza A(H5N1) virus in numerous countries in Asia and Africa and the increase in human cases, demonstrate that influenza ... surveillance programs Surveillance of avian influenza H5N1 virus in Asia and Africa Information of human cases of avian influenza A(H5N1) reported to the WHO, were retrieved from the Global Alert and
Ngày tải lên: 21/06/2014, 19:20
Desiccant enhanced evaporative air-conditioning (DEVap): evaluation of a new concept in ultra efficient air conditioning docx
... retraining DEVap has unknown longevity and reliability compared to standard A/C The availability of natural gas or other thermal energy sources may be an issue in certain places However, DEVap ... exhaust air (EA) flows Today’s A/C systems have: • Reasonable operations and maintenance (O&M) costs: o Cost of energy to operate o Ease of maintenance (for which the expectation is maintain ... concentration by weight salt in water solution) absorbs the water vapor and releases heat The heat is carried away by a heat sink, usually chilled water from a cooling tower As water vapor is absorbed
Ngày tải lên: 27/06/2014, 14:20
Báo cáo lâm nghiệp: "Processes of loss, recruitment, and increment in stands of a primeval character in selected areas of the Pieniny National Park (southern Poland" ppt
... increment was found in a pure fir (Abies alba) stand of Facimiech (9.4 m3/ha/year, i.e 1.4% of actual stand volume determined in 1997) being in the optimum stage, phase of aging and regeneration, and ... character in the Babia Gĩra Mt National Park Journal of Forest Sci-ence, 47: 60–74. JAWORSKI A., PALUCH J., 2002 Factors affecting the basal area increment of the primeval forests in the Babia ... m3/ha/year (Table 2), and the ratio between volume of annual loss and stand volume in 1997 was 2.2% (Table 3) Mean annual basal area increment during the control period was 0.38 m2/ha (Table
Ngày tải lên: 07/08/2014, 03:22
Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt
... Phenological data are a certain expression of the climate character of a given region Thus, they can contribute to assess the variability of weather and also to evaluate the impacts of potential climatic ... duration of the stage of budbreak and the beginning of foliage became evident in all monitored species most mark-edly Because of a rapid increase in temperatures in May 2006, the duration of ... beginning of yellowing and 100% yellowing lasted 25 days in larch The phenological stage of 100% leaf fall occurred on average the 328th day during the last 4 years at the sum of temperatures above
Ngày tải lên: 07/08/2014, 03:22
Báo cáo lâm nghiệp: "Spatio-temporal pattern of bog pine (Pinus uncinata var. rotundata) at the interface with the Norway spruce (Picea abies) belt on the edge of a raised bog in the Jura Mountains, Switzerland" doc
... same class reduction (AGC single value) Abrupt growth change mean curve (AGCm curve) was based on annual values and was the mean of all AGC single values of all bog pines of the transect, using ... Gobat J.-M., Stand structure, invasion and growth dynamics of bog pine (Pinus uncinata var rotundata) in relation to peat cutting and drainage in the Jura Mountains, Switzerland, Can J For Res ... scale clear cuttings around Jura bogs could have enhanced pine encroachment Indeed, increasing draught could promote the evapotranspira-tion of the dense Sphagnum carpet, causing a lowering of
Ngày tải lên: 08/08/2014, 01:21
Báo cáo khoa hoc:" Prediction of the response to a selection for canalisation of a continuous trait in animal breeding" pps
... repeated measurements on a single individual, and evaluation of one individual from the performances of its offspring. Trang 4Animal model: basic modelA model linking a phenotype yof a given animal ... performance of an individual Trang 5q individuals measured environments, generalheteroscedastic model can be stated as: ,-/where yg is the jth performance of a particular animal in a particular (animal ... of the theoretical approach by means of simulations and test the ability of the extended models and corresponding numerical procedures to tackle actualdata and evaluate the potential for canalising
Ngày tải lên: 09/08/2014, 18:21
Báo cáo khoa hoc:"Association of a missense mutation in the bovine leptin gene with carcass fat content and leptin mRNA levels" pps
... A G C G T C C A T CG C A A G T C A A r g 3 6 - T T C T T C T A G T G A G C G T C C A T T G C A A G T C A Cy s 41- G T G A A C A A A C C T A T A A A C A T G T A C A G 3 6 - G T G A A C A A A ... C C T A T A A A C A T G T A C A G 41- A C A A G A A T T C C A A C 3 6 - A C A A G A A T T C C A A C Figure 1 Entire leptin exon 2 sequence from bulls #41 (lean), and #36 (fat) The signal sequence ... Subsequently, a cytosine (C) to thymine (T) transition that encoded an amino acid change of an arginine to a cysteine was identified in exon 2 of the leptin gene A PCR-RFLP was designed and allele frequencies
Ngày tải lên: 09/08/2014, 18:21
báo cáo khoa học: "Changes in the distribution of the genetic variance of a quantitative trait in small populations of Drosophila melanogaster" docx
... Original article Changes in the distribution of the genetic variance of a quantitative trait in small populations of Drosophila melanogaster C.López-Fanjul, J. Guerra A. García ... to linkage disequilibrium from sampling. Starting from a population in linkage equilibrium, CV(V At ) should initially increase, rapidly approaching an asymptotic value. ... evolution of the between- and within-line variance of a quantitative trait. In such analyses, the between-line variance, in the absence of maternal effects, is essentially genetic,
Ngày tải lên: 09/08/2014, 22:22
Báo cáo y học: "The infectivity and pathogenicity of a foot-and-mouth disease virus persistent infection strain from oesophageal-pharyngeal fluid of a Chinese cattle in 2010" potx
... Reference Laboratory of China, Lanzhou Trang 3Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu 730046, China Aff2 Xinjiang Animal health supervision Institute, Urumuqi ... liuzaixin3@hotmail.com Aff1 State Key Laboratory of Veterinary Etiologic Biology, Key laboratory of Animal Virology of Ministry of Agriculture, National Foot-and-Mouth Disease Reference Laboratory ... 830060, China Abstract Background Foot-and mouth disease (FMD) is an acute, febrile, and contagious vesicular disease affecting cloven-hoofed animals Some animals may become persistent infected carriers
Ngày tải lên: 11/08/2014, 21:22
báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx
... GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA ... CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACCATCC TCGTCCGTCAGTAGCCACGTACAGTATC ... TCGTCCGTCAGTAGCCACGTACAGTATC CACAAAACCAAAACTTCACATCCCATCC CTCACTATGGATTCTCCTAGCGGTGTCG Page 10 of 13 (page number not for citation purposes) BMC Plant Biology 2009, 9:30 μg protein was incubated in presence of
Ngày tải lên: 12/08/2014, 03:20
Báo cáo y học: "Expression of a protein involved in bone resorption, Dkk1, is activated by HTLV-1 bZIP factor through its activation domain" potx
... 5′-GCATGACACAGG CAAGCATCGAAA; ACTB-F, 5′-ACCAACTGGGACGA- CATGGAGAAA; ACTBR, 5′ -TAGCACAGCCTGGA- TAGCAACGTA. The DKK1b primer pair was used for standard PCR amplification of cDNA prepared with the DKK1a-R ... TGGAATTTGGGATGGGAAGGACAC; DKK1-1854R, 5′-CACC ACCAAGTAAAGCCAGTGACA; DKK1-991F, 5′-CATTCGGAAGCGTTGC GATGTGAT; DKK1-991R, 5′-ACTTGATTAGGCAGACGCGTGAGA; DKK1-331F, 5′-ACTTGTGTGCACAGTCAGCGAGTA; DKK1-331R, ... GATCTACA; UBE2D2-R, 5′ -ACTTCTGAGTC- CATTCCCGAGCTA; Tax-F, 5′ -ATGGCCCACTTC CCAGGGTTTGGA; Tax-R, 5′-ACCAGTCGCCTTGTA- CACAGTCTC; HBZ-S1-F, 5′ - TTAAACTTACCTA- GACGGCGGACG; HBZ-S1-R, 5′-GCATGACACAGG
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Mutation of a diacidic motif in SIV-PBj Nef impairs T-cell activation and enteropathic disease" potx
... Trang 10animal Such changes were most prominent in the gas-trointestinal tract (Figure 6A), where blunting and fusion of intestinal villi, massive infiltration of lymphoid cells into the lamina ... sequenced independent iso-lated sequences (data not shown) Inocuiso-lated animals dis-played a rapid rise in cell-associated viral load with maximal viral load at day 9 to 12 p.i (Figure 5A and 5B) and ... activation and T cell proliferation In contrast, acutely lethal enteropathic SIVsmm strain PBj induces a strong immune activation and causes a severe acute and lethal disease in pig-tailed macaques
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "The economic burden of inpatient paediatric care in Kenya: household and provider costs for treatment of pneumonia, malaria and meningitis" ppsx
... 3.50 Kenyatta National Hospital Day in Kenyatta National Hospital 17.46 Guinness et al (2002)[16] Day in provincial hospital 13.52 Average Nganda et al (2003)[17] & Guinness et al 2002[16] Day ... pneumonia and malaria cases To obtain the average total cost of treatment per case we added up the cost of drugs, diagnostic investigations and hospital stay costs Average treatment costs at the national ... pneumonia, malaria and meningitis 90% of the children had only a single diagno-sis: 211 had malaria, 205 had pneumonia, and 102 had meningitis The remaining 54 children had more than one of the diagnoses,
Ngày tải lên: 13/08/2014, 11:22
Báo cáo y học: "On-ward participation of a hospital pharmacist in a Dutch intensive care unit reduces prescribing errors and related patient harm: an intervention study" pps
... patient that required prolonged hospitalization (Category F). Change route of administration Azathioprine in oral form was causing abdominal pain This adverse reaction was not recognized in a ... periods A mul-tivariate, backward logistic regression analysis was applied to calculate odds ratios of finding a prescribing error by an ICU hospital pharmacist at least once during a patient’s stay ... mainly in North America, is on-ward participation of a clinical pharmacist in an ICU team As the Dutch Healthcare System is organized differently and the on-ward role of hospital pharmacists in Dutch
Ngày tải lên: 13/08/2014, 21:21
Báo cáo sinh học: "Segregation of a major gene influencing ovulation in progeny of Lacaune meat sheep" pdf
... and Bindon [23], and Davis et al [7] in Booroola Merinos, various authors like Hanrahan and Owen [13], Hanrahan [12], Jonmundsson and Adal-steinsson [17], Bradford et al [4], Radomska et al [26], ... non-prolific strain) on six private farms, and of 72 adult Lacaune ewes of the “Gebro strain” (a Lacaune strain of suckling ewes known not to be prolific) on the Inra Langlade farm “F1” ewe lambs born ... regarding the sire variance as a quarter of the additive genetic variance As in Le Roy et al [19] and Ilahi et al [16], a segregation analysis method was run, comparing likelihoods under two inheritance
Ngày tải lên: 14/08/2014, 13:21
Báo cáo sinh học: "Comparison of four statistical methods for detection of a major gene in a progeny test design" pptx
... segregating) The parameters describing the population (means and standard deviations within genotype) are estimated by maximizing the marginal likelihood of the Yij The other statistics studied are ... likelihoods under H and H are calculated using equality (1) and taking account of: Then: Trang 6and; with: The well known asymptotic properties of the LR test under H are the main advantage of this method ... described above were made using the quadrature and Trang 9optimization subroutines of the NAG fortran library In order maximize the likelihoods of the sample we used a Quasi-Newton algorithm in which
Ngày tải lên: 14/08/2014, 20:20
Bạn có muốn tìm thêm với từ khóa: