connecting two or more computers with a network
Pricing and lot sizing optimization in a two-echelon supply chain with a constrained Logit demand function
... Pricing and lot sizing optimization in a two-echelon supply chain with a constrained Logit demand function Yeison Díaz-Mateus a , Bibiana Forero a , Héctor López-Ospina b* and Gabriel Zambrano-Rey ... supplier and vendor To formulate the problem the following parameters and variables are taken into account: Parameters Variables Trang 4 208 Assumptions The maximum willingness to pay, that each ... from the same group in order to analyze and describe logistic and demand impacts It is important to clarify that an aggregate demand will be obtained, that is, the sum of demands for all clusters...
Ngày tải lên: 14/05/2020, 22:32
Bilingual by choice raising kids in two (or more) languages
... National Association for Bilingual Education(NABE), we embrace this mantra and advocate learning more thanone language and culture We are now a global society and we mustlearn to create unity within ... there are two (or more) words to nameone particular object (3) Before their second birthday, Natasha andSofiya made the connection that French and English represented twoseparate languages aware-As ... speaking two languages from birth will cause a lan-guage delay As the American Speech-Language-Hearing Associationstipulates, “Children all over the world learn more than one languagewithout developing...
Ngày tải lên: 10/10/2022, 15:32
A simple sentence is a sentence containing only one clause or more specifically, an independent clause with a subject and a predicate
... and emotions and often begins with the pronoun what or the adverb how What refers to a noun, how to an adjective or an adverb Exclamatory sentences always have direct word order An exclamation ... or phenomenon asked about exists or does not exist; accordingly the answer may be positive or negative, thus containing or implying “yes” or “no” A general question opens with a verb operator, ... to), wherefore (=what for, why) Adverbial phrases such as how long, how often may also function as question words With the help of these means the speaker can specify the information about the...
Ngày tải lên: 06/01/2022, 23:14
báo cáo khoa học: " Dissecting grain yield pathways and their interactions with grain dry matter content by a two-step correlation approach with maize seedling transcriptome" pps
... dry matter content by a two-step correlation approach with maize seedling transcriptome Abstract Background: The importance of maize for human and animal nutrition, but also as a source for bio-energy ... percentages in italics represent the first two largest categories in each set of genes. Trang 10Table 3: Statistical enrichment analyses of metabolic pathways.Metabolic pathway Back-ground Acyl-CoA ... functional categories based on the MIPS Functional Cat-alogue (Table 2, Additional file 2) The functional cate-gory METABOLISM contained most of the genes for both traits For grain yield, it was followed...
Ngày tải lên: 12/08/2014, 03:21
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
... alpha 2, smooth muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt VIRvsLTNP CD8 4.3 2.8 PSMA5 NM_002790.2 proteasome subunit, alpha type, 5 PSMA5L tgaatgcaacaaacattgagc PSMA5R ... wereclosely associated with the MAPK pathway and 10 withcell signaling such as TCR and chemokine and cytokinepathways Unique pathways associated with non-progressive HIVdisease Among the 15 MAPK-associated ... Sentrix Human-6 V2Expression BeadChip (Singapore) After passing qualityassessment, data normalization was performed and a lin-ear model fit in conjunction with an empirical Bayes sta-tistics were...
Ngày tải lên: 13/08/2014, 01:20
SECURE WEB APPLICATIONS AGAINST OFF-LINE PASSWORD GUESSING ATTACK: A TWO WAY PASSWORD PROTOCOL WITH CHALLENGE RESPONSE USING ARBITRARY IMAGES
... WEB APPLICATIONS AGAINST OFF-LINE PASSWORD GUESSING ATTACK: A TWO WAY PASSWORD PROTOCOL WITH CHALLENGE RESPONSE USING ARBITRARY IMAGES Master of Science Zebin Lu 04/20/2012 Trang 3ATTACK: A TWO ... example, an attacker who makes a fake website may obtain the hash of users’ passwords, and use that information to arrange off-line password guessing attacks Based on TPP, we incorporated challenge ... potential security threats in those protocols For Trang 15example, an attacker who makes a fake website may obtain the hash of users’ passwords, and use that information to arrange off-line password...
Ngày tải lên: 24/08/2014, 10:37
BETWEEN TWO WORLDS: AN EXPLORATION OF PRIVACY MANAGEMENT ISSUES ARISING FOR FIRST-YEAR COLLEGE STUDENTS DEALING WITH A MOTHER‟S BREAST CANCER DIAGNOSIS AND TREATMENT
... parent with cancer In addition, the fundamental changes that take place with a disease such as breast cancer may mean significant alterations of privacy rules both for the child and for the parents ... Ms A said, the “one thing that really came up with the breast cancer was that you need to talk about it.” CPM Case 1 Analysis CPM provides a conceptual framework for evaluating how people manage ... provides a framework for evaluating communication issues about privacy and disclosure that arise in everyday life Communication privacy management is an evidenced-based theory that is dialectical in...
Ngày tải lên: 24/08/2014, 10:52
Acts of dissension how political theatre has been presented in the past and what strategies the playwright can employ to make issues of radical or alternative politics more accessible to a mainstream theatre aud
... got a son with asthma, we have to be able to call a doctor in an emergency Yeah, you and everybody else lady (PAUSE) Guard in the elevator, guard at the end of the corridor on our floor, probably ... Maria’s ordered at the nursery will go there (PAUSE) It’s pretty the way it goes like that Rose rose azalea rose azalea azalea rose, rose around the corner 6 (MANDY and MUM are watching TV.) MANDY: ... No, I realised I was a gas chamber attendant and had to quit MUM: A gas chamber attendant PIKE: Forget it Forget I even mentioned it, enjoy your pizza (MUM goes) Trang 12MANDY: Why are you being...
Ngày tải lên: 07/08/2017, 11:40
DSpace at VNU: Exact solutions of a two-fluid model of two-phase compressible flows with gravity
... propagating with constant speedσcan be made stationary thanks to a classical Galilean change of variable(x,t) → (x− σt,t) We therefore develop in this paper a way for computing stationary waves ... equations of state of gas and liquid phases In this paper, we assume that the gas phase has the equation of state of the perfect gas for the air and we use the stiffened gas equation of state for ... Trang 1Contents lists available atSciVerse ScienceDirect Nonlinear Analysis: Real World Applications journal homepage:www.elsevier.com/locate/nonrwa Exact solutions of a two-fluid model of two-phase...
Ngày tải lên: 16/12/2017, 09:19
Coping with the land game: A network analysis of community resilience in Hue’s peri urban areas, Vietnam
... community access to human, information, financial and trade networks In its relationship to the city, and acting as a trade hub as an important local commercial centre, mobility has always taken place ... of assets that are considered as a human, natural, financial, physical and social form of capital, in this study, mobility capital or motility is added as a sixth category Kauffman first introduced ... multi-local nature of livelihood trajectories plays an important role within the economic and material success of a household The proximity of Dạ Lê Chánh village to an urban area works as an advantage...
Ngày tải lên: 05/02/2020, 02:37
Natural hybridization and asymmetric introgression at the distribution margin of two Buddleja species with a large overlap
... collection, leaf material was transferred to zip-lock plastic bags con-taining silica gel Measurements and data analysis of morphological traits Three leaves from ten healthy individuals for each of ... crispa and B officinalis alleles it is unlikely that this pattern could have been caused by ancient shared alleles, and a more in-depth search around the sample site revealed several morphologically ... scenic area of Xishan B officinalis individuals can be found throughout the area, and certainly more than 500 individuals can be found on Xishan; a population size estimate of B crispa is more difficult,...
Ngày tải lên: 26/05/2020, 21:31
A novel two-phase approach for solving the multi-compartment vehicle routing problem with a heterogeneous fleet of vehicles: a case study on fuel delivery
... have become popular in the academic literature, and have been applied in many applications such as logistics, transportation and supply chain management (Wichapa & Khokhajaikiat, 2017) Although ... two-phase heuristics are the Sweep algorithm, FJA, Petal algorithm and Taillard’s algorithm The FJA (Fisher & Jaikumar, 1981) is one of various Two-phase algorithms, and is a well-known algorithm ... as an NP-hard problem, is a well-known problem in operations research and combinatorial optimization (Chokanat et al., 2019; Wichapa & Khokhajaikiat, 2018).Much attention of researchers has...
Ngày tải lên: 26/05/2020, 22:45
Efficacy of bevacizumab combined with chemotherapy in the treatment of HER2- negative metastatic breast cancer: A network meta-analysis
... (HR) with its 95% CI was calculated for PFS, while the odds ratio (OR) with 95% CI was calculated for ORR We used a Fig 2 A network meta-analysis of interventional strategies for the treatment ... 4TableTrang 5TableTrang 6bayesian random effects network meta-analysis ap-proach to analyze the indirect data for multiple treatment comparisons We compared the results of direct and indirect meta-analysis ... investigator Relevant PFS and ORR were extracted for primary and secondary endpoint respectively Statistical analysis We performed direct meta-analysis for all treatment comparisons, and statistical...
Ngày tải lên: 17/06/2020, 03:29
A two dimensional sideways problem with random discrete data
... Trang 1Contents lists available atScienceDirectComputers and Mathematics with Applications journal homepage:www.elsevier.com/locate/camwa A two-dimensional sideways problem with random discrete ... reasonable to take discrete measured data with random noise into account In the paper, approximations of interior measurements from the discrete data are established First, a one-dimensional ... 1–3 Table 1 shows ERE in(56) for 𝑦0 = 0.1, for various values of 𝑛 and for different noise levels Therein we calculate ERE with 𝐿 = 1 for the data without noise, and with 𝐿 = 100 for the data disturbed...
Ngày tải lên: 18/02/2021, 15:24
Treatment of slaughter wastewater using two stages anaerobic reactor with PVA gel as a biomass carrier
... liters each, two tanks are connected one after the other and connected to two rear air gathering tanks to measure biogas volume generated after treatment in each reactor tank Wastewater used for operation ... slaughter wastewater of the factory of Vietnam Animal Husbandry Industry Co., Ltd (VISSAN) The model is located at the lab of Environment and Natural Resources Department, with 2 reaction tanks of 5 ... COD, anaerobic sludge fed to the model with the concentration of MLSS in two reaction tanks of AD-W8 model is maintained at a concentration of about 1500mg/l The temperature of two reaction tanks...
Ngày tải lên: 08/03/2021, 20:14
Have you had any experience with a brand that has done a great job with relationship marketing, permission marketing, experiential marketing, or one one marketing what did the bran to d do why was
... Trang 1GROUP 11 2 3 4 Have you had any experience with a brand that has done a great job with relationship marketing, permission marketing, experiential marketing, or one-to-one marketing? What ... marketing strategy enhances client relations and makes up their fidelity, allowing the brand to establish a special relation to the client as well as trust and reliance that raises audience satisfaction ... retain loyal customers: Loyal customers are always a stable source of revenue Making them feel exceptional and as though they are "emperors" produces satisfaction and loyalty TIEU LUAN MOI...
Ngày tải lên: 24/05/2022, 07:29
Have you had any experience with a brand that has done a great job with relationship marketing, permission marketing, experiential marketing, or one one marketing what did the bran to d do why was
... client relations and makes up their fidelity, allowing the brand to establish a special relation to the client as well as trust and reliance that raises audience satisfaction and separates Shopee ... Trang 1GROUP 1 Have you had any experience with a brand that has done a great job with relationship marketing, permission marketing, experiential marketing, or one- -one marketing? What did ... retain loyal customers: Loyal customers are always a stable source of revenue Making them feel exceptional and as though they are "emperors" produces satisfaction and loyalty Trang 7coupons...
Ngày tải lên: 07/06/2022, 20:48
differential cellular gene expression in duck trachea infected with a highly or low pathogenic h5n1 avian influenza virus
... literature, as com-pared to the mammalian species, our annotation based analysis assume a functional equivalence of the avian and duck genes with their mammalian (human, rat and mouse) orthologs ... differentially expressed in duck trachea after H5N1 infection using the significance analysis micro-array software A and B: One-class analyses of microarray data were performed for each dataset: after ... After normalisation of the raw data, we performed a first statistical analysis by comparing signals obtained with probes corresponding to infected tracheas (HPAI-or LPAI-infected) versus signals...
Ngày tải lên: 01/11/2022, 09:52
Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx
... CTCCAGACAGCCGCCTGGTTAGC CACACCCTGTAGAGGGCTCTCCAG CCTTTCTTATCAGCCACCCTGTAGAG GGAATACAGCTGGCAAGGC TGATCCTGGGCGTATGCGC GCCCCAACTAATGCATTGGTCACTAG CCAAGCAGTCGCATTGGCCCC a The altered nucleotides on the PMV cDNA are ... P31 7A- 989R N32 3A- 1007R L32 5A- 1014R REP/Y -A 1044R-C /A REP/F -A REP/D -A MUTPMV-1236R REP/W -A CCCCAGCGGCTTCGTTCTTTGC GGAACCCCAGCAAACTCGTTCTTTGC CTGTGGGTTTTGCAACCCCAGCG CAGCCAACTGGGCAGCCTCTGTG CTCCAGACAGCCGCCTGGTTAGC ... peroxidase (Amersham Pharmacia Biotech, Piscataway, NJ) was used at a 1:5,000 dilution and assayed by enzymatic reactions The remaining half of the extract was prepared for RNA blots, as described...
Ngày tải lên: 19/06/2014, 08:20
Tài liệu MCSE Study Guide - Designing a Network Infrastructure with Windows 2000 Exam 70-221 ppt
... www.troytec.com Availability - The percentage of time that the network infrastructure is up and running and available for use • Analyze data and system access patterns Assess the peaks and valleys that exist ... single network infrastructure Several offices have small networks, but these networks not connect each other or with the central hospital network Other offices have one or more stand-alone computers ... interoperable, and manageable Client computer configuration on the network should be automatic and fault tolerant All network services must be completely fault tolerant and available at all times For...
Ngày tải lên: 21/12/2013, 04:19