... morphological, composition and gas response studies, Sens Actuator B 115 (2006) 33–41 [24] A Wisitsoraat, A Tuantranont, C Thanachayanont, V Patthanasettakul, P Singjai, Electron beam evaporated carbon ... as anode material for lithium-ion batteries, Mater Res Bull 38 (2003) 831–836 [18] W Wanga, P Serp, P Kalck, J.L Faria, Photocatalytic degradation of phenol on MWNT and titania composite catalysts ... were calcinated at various temperatures of 400, 450, 500, and 550 ◦ C The calcination at 500 and 550 ◦ C was carried out at vacuum of 10−2 Torr to avoid the burning of CNTs because a thermal gravimetric...
Ngày tải lên: 19/03/2014, 16:48
... 673 K) are given in Fig 4a and b, respectively We can notice that the low value of the adsorbate ionization rate saturates at a value lower than 5.4 × 10−3 while the total covering rate reaches ... sites are the only adjustable parameters of simulations The other parameters are related to the sensitive layer material The oxygen vacancy density is assumed to be × 1019 cm−3 (corresponding to a ... polycrystalline layer made up of grains which have a great disparity of shape and size In this work, the grains are supposed to be quasi-spherical, identical in size, and single-crystal They are jointed,...
Ngày tải lên: 20/03/2014, 13:04
sensitivity properties of a novel no2 gas sensor based on mesoporous wo3 thin film
... rhodium–alumina catalyst, J Catal 43 (1976) 131–142 225 at National Cheng Kung University, Tainan, Taiwan His major research has related to mesoporous materials, and battery materials Jiann Shieh received ... laboratories Hsinchu, Taiwan His major research has related to PECVD Ti-Al-C-N system nanocomposite thin films, semiconductor gas sensor, mesoporous materials, nanocrystal, and nanowire materials ... Tainan, Taiwan, 2001 His major research has related to mesoporous materials, semiconductor gas sensor, and nanomaterials Min Hsiung Hon is a professor in the Department of Materials Science and...
Ngày tải lên: 20/03/2014, 13:07
Báo cáo toán học: " Measurement of beta amyloid peptides in specific cells using a photo thin-film transistor" pot
... phosphate-buffered saline, laminin as an extracellular matrix was coated on the channel, and the channel was kept overnight in an incubator at 37°C We prepared HeLa cells for the expression of A ... whole experiment and supported the mathematical approach and the organization of this article All authors read and approved the final manuscript Acknowledgements This research was supported by ... Extracellular amyloid formation and associated pathology in neural grafts Nat Neurosci 2003, 6:370-377 Small DH, McLean CA: Alzheimer’s disease and the amyloid b protein: what is the role of amyloid?...
Ngày tải lên: 20/06/2014, 20:20
Báo cáo hóa học: " Magnetotransport in an aluminum thin film on a GaAs substrate grown by molecular beam epitaxy" ppt
... Figure 3a, it is 40nm 0nm Figure X-ray and AFM of the Al thin film (a) The scanning of Al(111) peak of the sample (b) An AFM × 5-μm2 image of a 60-nm-thick Al thin film Lo et al Nanoscale Research ... thin film studied here (60 nm) It prevails that surface scattering is important instead of the grain boundary scattering in such a thin film For a polycrystalline material, grain boundary scattering ... the AFM and X-Ray measurements All authors read and approved the final manuscript Author details Department of Physics, National Taiwan University, No 1, Sec 4, Roosevelt Rd Taipei 106, Taiwan...
Ngày tải lên: 21/06/2014, 06:20
báo cáo hóa học:" Structural and optical properties of a radio frequency magnetron-sputtered ZnO thin film with different growth angles" pdf
... drafted the manuscript K-HK and MP carried out the sample preparation JL and H-SH performed data acquisitions and analysis All authors read and approved the final manuscript Average (400~800 ... Torr A pre-sputtering treatment was performed to clean the target surface for 10 using argon plasma A distance between the target center and the sample substrate was kept at 9.5 cm, and we manually ... angles of the ZnO films A 99.99% ZnO target was fixed, and a sample holder was mechanically tilted to get several different angles against the target With many experiments and SEM measurements, we...
Ngày tải lên: 21/06/2014, 17:20
A discrete dislocation study of thin film interfacial fracture
... Lastly, I will like to acknowledge the Creator's hand in all things physical and not He had directed my path to graduate school, and made various opportunities available to me when I was not actively ... interplay between sample dimensions and length scales inherent to dislocation generation and leads to dislocation starvation in small samples The DD study of Deshpande et al (2005) was also able ... the overlap between data in Lane et al (2000b) and the data in Litteken et al (2005) for residual stress +306MPa suggests the materials in Lane et al (2000b) to have a similar residual stress...
Ngày tải lên: 11/09/2015, 21:37
High depth resolution rutherford backscattering spectrometry with a magnet spectrometer implementation and application to thin film analysis 2
... _ (a) (b) Fig 3.5 (a) The steerer table and (b) the 90° analyzing magnet on the analyzer table Source: [33] On both steerer and analyzer tables, a beam profile monitor (BPM) and a faraday cup ... the AC cycles Potential differences across each charged capacitor along the stack eventually add up to the terminal voltage A generating voltmeter (GVM) measures the potential of the terminal ... to times that of air, and serves to prevent corona buildup and tank sparks Other forms of electrical insulation are the vacuum and glass insulation within the accelerator tube, the plastic support...
Ngày tải lên: 14/09/2015, 08:44
High depth resolution rutherford backscattering spectrometry with a magnet spectrometer implementation and application to thin film analysis 3
... pump and valve network During sample change, programmed sequences can be initiated from the graphical user interface on the control cabinet which automatically activates the appropriate valves ... contained within the load lock chamber (a) (b) Goniometer Gate Valve V1 V1 Main Chamber Load lock chamber (c) Main chamber Main viewport Fig 3.7 (a) Main chamber, goniometer and load lock (b) Load lock ... goniometer attachment in the main chamber from a load-lock chamber through a gate valve A controller program at the control cabinet oversees the vacuum interlocks system and allows for programmed or manual...
Ngày tải lên: 14/09/2015, 08:44
High depth resolution rutherford backscattering spectrometry with a magnet spectrometer implementation and application to thin film analysis 4
... Mathematica, and ε was calculated using the measured value of B A graph of surface edge position vs ε was plotted and compared to the numerical and analytical calculated data using Mathematica ... Numerical and analytical (Direct and Matrix) calculations Numerical calculations show slightly better agreement to the experimental than the analytical calculations, due to more accurate modeling ... Beam entry parameters The backscattered ion beam entering the magnet is calculated in the same manner in both Direct and Matrix calculations The ion beam was assumed to have incident on a target...
Ngày tải lên: 14/09/2015, 08:44
High depth resolution rutherford backscattering spectrometry with a magnet spectrometer implementation and application to thin film analysis 1
... experimental data was compared to the SIMION and the analytical calculations……………… 81 List of Figures xvii 5.1 (a) Plot of different sets of calibration data measured at approximately months interval ... candidates [2 − 4], including dielectrics based on Si, Al, Hf, Zr, Ti, Y, Ta and Lanthanides In fact, Intel has fabricated a functional CMOS gate stack with a SiOxNy gate dielectric as early as ... SiOxNy and Hf-based films will have to be used Lanthanide (Rare-Earth)-based films are one of the candidates for high-k replacements as they have large band gaps, high dielectric constants and low...
Ngày tải lên: 14/09/2015, 08:44
A simulation by using cohesive zone model for indentation test in thin film substrate systems
... critical indentation load and a critical indentation depth associated with the initial delamination crack at the thin film/ substrate interface, and using the mechanical analysis, the general properties ... Therefore, the shape of the traction-separation law may also have a significantly effects on the crack initiation and propagation processes Recent numerical simulations by Chandra et al [34] also discovered ... that researchers can predict crack propagation in many media using fracture mechanics theory, such as the theory of Griffith’s fracture for an ideal elastic material [16] Linear elastic fracture...
Ngày tải lên: 26/09/2015, 09:56
A study of the si3n4 cu ta thin film systems for dual damascene technology
... diffusion barriers are examined, with particular emphasis on tantalum-based barriers Thin film adhesion characteristics and its associated improvement techniques are presented Plasma surface modification ... α-Ta transformation 24 Yong Lai Lin Clare or in as-deposited α-Ta films A study of Si3N4/Cu/Ta thin film systems for dual damascene technology A suggested mechanism of the above phase transformation ... PECVD Si3N4 films are used effectively as final passivation layers often in combination with an oxide layer in IC, UV-erasable EPROM and GaAs MESFETS fabrications Plasma nitride films are excellent...
Ngày tải lên: 26/09/2015, 10:13
Introduction to surface and thin film processes-JOHN A. VENABLES
... outwards) Soapy water (or beer) doesn’t mind being agitated into a foam with a large surface area; these are examples one can ponder every day! (2) A clean surface in ultra-high vacuum has a higher ... considerations At equilibrium, a small crystal has a specific shape at a particular temperature T Since dFϭ0 at constant T and volume V, we obtain from the previous section that ␥dAϭ0, or ͐␥dA is a ... practical and analytical abilities across these fields If used for a course, these problems can be employed to test students’ analytical competence, and familiarity with practical aspects of laboratory...
Ngày tải lên: 21/12/2016, 11:07
A discourse analysis of film reviews in english and vietnamese
... the film, but the name of the film is always present in both languages Two parts that are always present are name of the film and director in EFRs and name of the film and main contents of the film ... and how ideas in each part are arranged Secondly, learners must have a good lexical choice to attract readers and emphasize the quality of a film Thirdly, defining the prominant syntactic structures ... internet And the study is defined in comedies, thrillers, love story films, action films, socio-psychological films and 1.1 RATIONALE Nowadays, there are many ways of entertaining Films are a popular...
Ngày tải lên: 26/11/2013, 13:26
Tài liệu Báo cáo " Survey of WO3 thin film structure built on ito/glass substrates by the Raman and xrd spectroscopies" doc
... Afify, A Abdel-All, phys stat sol (a) 174 (1999) 301 P.S Patil, P.R.Patil, E .A Ennaoui, Thin solid films 370 (2000) 38 M.J Hutchins, N .A Kamel, N El-Kadry, A. A Ramadan, K Abdel-Hady, phys stat sol ... (200) peaks are weakened down to the font of (001) peak In these films WO3 particles are well crystallized For a Raman spectrum of that film, peaks, characterizing crystalline phases, such as 799.4 ... a great anomaly in orientation due to the appearance of peaks in larger diffraction angles With 350 nm thickness ITO player, WO3 film preferentially grows along direction (001) with larger lattice...
Ngày tải lên: 13/02/2014, 03:20
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT ... TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT Average ... 3, and Identical products were formed by PCR of DENV-2 cDNA and RT-PCR Average amplicon location (nucleotides) Average amplicon size (bp) DENV-1 CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu COUNSELING and PSYCHOTHERAPY with ARABS and MUSLIMS A Culturally Sensitive Approach doc
... happen to anybody This belief is documented in the verse, “Qol lan yosibuna illa ma katab Allah lana howa mawlana wa ala Allah falyatawakal el-mo amenin” (Al-tawbah #51) [Say: Nothing will befall us ... earth “Wabtag i fema a tak Allah al-dar el-aakhera wala tansa nasibak men al-dunia” (Al-Qusas #77) [But seek, by means of that which God has given you, to attain the abode of the hereafter and ... “Wala tahsabanna alatheena qotilou fi sabeel Allah amwatan bal ahya a and Rabbihem yorzaqoon” (Al -A mran #169) [Do not consider those who died for God dead but rather as living in God’s place.]...
Ngày tải lên: 15/02/2014, 15:20
Tài liệu Báo cáo khoa học: "Using Multiple Sources to Construct a Sentiment Sensitive Thesaurus for Cross-Domain Sentiment Classification" doc
... Pan et al (2010) Both the LSA and FALSA techniques are based on latent semantic analysis (Pan et al., 2010) For the Within-Domain baseline, we train a binary classifier using the labeled data ... and Shivakumar Vaithyanathan 2002 Thumbs up? sentiment classification using machine learning techniques In EMNLP 2002, pages 79– 86 Patrick Pantel and Deepak Ravichandran 2004 Automatically labeling ... mutual information between a feature (unigram or bigram) and a domain label After selecting salient features, the SCL algorithm is used to train a binary classifier SFA is the spectral feature alignment...
Ngày tải lên: 20/02/2014, 04:20