... 0.001 Trang 9The field study was financed via Sahlgrenska Academy, University of Gothenburg. Availability of data and material The data will not be shared because it will be used as material for ... urban and rural children of Hanoi, Vietnam Methods: A longitudinal study of a cohort of 2677 children aged 3 to 6 years old at the beginning of the study was conducted in urban DodaLab and rural ... References 1 Magarey AM, Daniels LA, Boulton TJ Prevalence of overweight and obesity in Australian children and adolescents: reassessment of 1985 and 1995 data against new standard international definitions
Ngày tải lên: 20/02/2020, 22:14
... College of Pharmacy, University of the Punjab, Allama Iqbal Campus, Lahore 54000, Pakistan 2 Section of Pharmaceutics, University of the Punjab, Allama Iqbal Campus, Lahore 54000, Pakistan Full ... a day – Salt Intake: Salt intake was documented as normal if daily intake was equal to 1 teaspoon i-e., 6 g, while salt intake of≤4.5 g was considered low – Fat Intake: consumption of trans and ... period of time but were not allowed to intervene, and collection of data from a generalization of study results Additionally, no informa-tion was available regarding financial and other stressors affecting
Ngày tải lên: 23/09/2020, 11:08
effects of highly active antiretroviral therapy and its adherence on herpes zoster incidence a longitudinal cohort study
... viral load and quality of life score Each HAART user was matched at the last visit before her HAART initiation to a visit of a HAART nạve participant with similar propensity score (±0.1%) For any ... matching and participant characteristics balancing Characteristics of all HAART using women (2053) and all HAART nạve women (760) at the WIHS enrollment, and characteristics of the subsets of ... effect of HAART adherence on HZ incidence, time varying HAART adherence level was used as exposure variable, which is similar to the as-treated analysis in a clinical trial To examine whether HAART
Ngày tải lên: 02/11/2022, 09:21
Biomarkers of endothelial dysfunction predict sepsis mortality in young infants: A matched case-control study
... Hayford2, Vanessa Tran2, Gulam Muhammed Al Kibria3, Abdullah Baqui4, Ali Manajjir5, Arif Mahmud4, Nazma Begum4, Mashuk Siddiquee6, Kevin C Kain1,2†and Azadeh Farzin4,7*† Abstract Background: ... Ang-2, Ang-2:Ang-1 ratio, and sICAM-Ang-2:Ang-1 at admission are associated with in-fant mortality Median plasma Ang-2 concentration at presentation was significantly higher among infants with suspected ... levels of Ang-2, sICAM-1 and the Ang-2:1 ratio at admission were associated with increased risk of death and the combined outcome of death and bacteremia Only the Ang-2:1 ratio was significantly associated
Ngày tải lên: 20/02/2020, 22:01
A case-control study of exposure to organophosphate flame retardants and risk of thyroid cancer in women
... 2013 and were scheduled at various times of day, based on participants’ availability Laboratory analysis of PFR metabolites For each participant, a 5-ml aliquot was analyzed for 6 PFR metabolites ... F, Giovanoulis G, van Waes S, Padilla-Sanchez JA, Papadopoulou E, Magner J, et al Comprehensive study of human external exposure to organophosphate flame retardants via air, dust, and hand wipes: ... measurements Additional file Additional file 1: Table S1a Spearman correlations among organophosphate flame retardants (specific gravity-corrected) ( n = 200). Table S1b Spearman correlations among
Ngày tải lên: 24/07/2020, 01:31
New use of low-dose aspirin and risk of colorectal cancer by stage at diagnosis: A nested case–control study in UK general practice
... information from a more recent version of the database showed that these patients had dropped out of the cohort (information that was not available in earlier versions of the database) b All variables ... data or manuscript writing, except for in the form of salary paid to MS-G. Availability of data and materials The datasets generated during and/or analyzed during the current study are available ... in-trial period Recent analyses of in-trial data show that aspirin substantially reduces metastatic CRC at initial diagnosis [4], which cannot be accounted for by an effect early in the aden-oma–carcinoma
Ngày tải lên: 06/08/2020, 03:47
The association between high birth weight and the risks of childhood CNS tumors and leukemia: An analysis of a US case-control study in an epidemiological database
... childrena The risk of high-birth-weight and SGA/AGA children compared to normal-birth-weight childrena LGA large for gestational age, SGA small for gestational age, AGA appropriate for gestational age ... childrena The risk of high-birth-weight and SGA/AGA children compared to normal-birth-weight childrena LGA large for gestational age, SGA small for gestational age, AGA appropriate for gestational age ... Department of Energy a Age at diagnosis for controls was calculated, using the year of diagnosis assigned by the original study, which was matched case-control study b DOE sites: a surrogate variable
Ngày tải lên: 06/08/2020, 04:21
Presence of human papillomavirus DNA in breast cancer: A Spanish case-control study
... and quality of DNA: All DNA samples were analyzed using a Nanodrop 1000 kit allowing calculation of the concentration of DNA and the A260/A280 and A260/A230 ratios, which indicate the purity of ... Alfonso Alba2, Tina-Aurora Martín-Bayón1, Hortensia Ballester-Galiana1, Gloria Peiró3, Pablo Caballero4and Jose Ponce-Lorenzo5 Abstract Background: Breast cancer is one of the most important neoplasia ... Trang 1R E S E A R C H A R T I C L E Open AccessPresence of human papillomavirus DNA in breast cancer: a Spanish case-control study Silvia Delgado-García1* , Juan-Carlos Martínez-Escoriza1, Alfonso
Ngày tải lên: 06/08/2020, 07:58
Absence of an association of human polyomavirus and papillomavirus infection with lung cancer in China: A nested case– control study
... Ya-Guang Fan for translation and study facilitation, Yong Jiang for data preparation, and Margaret M Madeleine, Lisa Johnson, and Alexa Resler for their consultation regarding study design and analytical ... playing a causal role in nearly all cervical cancers, a large proportion of other anogenital cancers, and more than a quarter of oro-pharyngeal cancers [22, 23] In addition, HPV infections are ... Trang 1R E S E A R C H A R T I C L E Open AccessAbsence of an association of human polyomavirus and papillomavirus infection control study Danny V Colombara1,2,7*, Lisa E Manhart1, Joseph J Carter2,
Ngày tải lên: 21/09/2020, 01:31
Performance of the colorectal cancer screening marker Sept9 is influenced by age, diabetes and arthritis: A nested case - control study
... adenomas, rather than Sept9 alone Along these lines we hypothesize that to reach optimal sensitivity and specifi-city of both adenomas and early stage carcinomas an in-creased plasma volume and ... individual This implies that all future blood-based assays, targeting a few ctDNA copies in a large pool of cfDNA, especially methylation-sensitive assays, may be affected Additional files Additional ... later diagnosed with cancer Factors potentially affecting assay performance To investigate if the outcome of the Sept9 test was af-fected by any of the available demographic or clinical variables
Ngày tải lên: 22/09/2020, 23:21
A case–control study of sporadic retinoblastoma in relation to maternal health conditions and reproductive factors: A report from the Children’s Oncology group
... an“ideal control” (age-matched and not a biological relative) was unavailable, cases were asked to suggest another potential child as a control Some families did not nominate any child as a control ... Mothers of bilateral and unilateral cases had lower edu-cational attainment and income than control mothers There was also some indication that mothers of bilateral cases were older (35+ years old) ... sporadic heritable and nonheritable retinoblastoma Cancer Res 1989;49(20):5730 –5. 8 Anand B, Ramesh C, Appaji L, Kumari BS, Shenoy AM, Nanjundappa, et al Prevalence of high-risk human papillomavirus
Ngày tải lên: 23/09/2020, 00:01
Biomarkers of thyroid function and autoimmunity for predicting high-risk groups of thyroid cancer: A nested case-control study
... of the data and manuscript preparation AS participated in the study design, data acquisition, and quality control of the data JL participated in the study design and quality control of the data ... of the data EKL and YJL participated in interpretation of the data JK contributed to the study concept and design, data acquisition, and quality control of the data All authors participated in ... conditional and unconditional approaches gave approximately the same results for the entire dataset All statistical analyses were performed using SAS 9.1 software (SAS Institute Inc., Cary, NC) A two-sided
Ngày tải lên: 14/10/2020, 13:07
A case-control study of glycemic index, glycemic load and dietary fiber intake and risk of adenocarcinomas and squamous cell carcinomas of the esophagus: The Australian Cancer
... esophageal cancer (EAC and ESCC cases combined) among men only A succeeding analysis of the same cohort indicated an increased risk of esophageal adenocarcinoma with high intake of added sugars in ... overall GI was calculated by dividing the total dietary GL by the total available carbohydrate intake Covariates Study participants provided detailed health and lifestyle information via a self-administered ... in-take was significantly related to gastric cardia adenocar-cinoma only A recent meta-analysis on dietary fiber and esophageal cancer risk, including a total of 10 population-based or hospital-population-based
Ngày tải lên: 14/10/2020, 13:08
A case–control study of pre-operative levels of serum neutrophil gelatinase-associated lipocalin and other potential inflammatory markers in colorectal cancer
... concentrations according to invasion depth (Panel A), maximal tumoral size (Panel B) and TNM stage (Panel C) of colorectal cancer Values are presented as medians and interquartile ranges Maximal tumor ... moderate discriminative power of serum NGAL suggest that, although serum NGAL may have a potential value for the evaluation of parietal invasion, it is not a suitable biomarker for diagnosis of ... the AGARIC study group Abstract Background: Chronic inflammation is a key feature of colorectal cancer (CRC), meaning that inflammatory biomarkers may be useful for its diagnosis In particular,
Ngày tải lên: 14/10/2020, 13:22
A multi-center population-based case-control study of ovarian cancer in African-American women: The African American Cancer Epidemiology Study (AACES)
... Crankshaw1and Patricia G Moorman1 Abstract Background: Ovarian cancer (OVCA) is the leading cause of death from gynecological cancer, with poorer survival for African American (AA) women compared ... intervals for case–control associations with BMI, education and annual income for early and advancedstage ovarian cancer, the African American Cancer Epidemiology Study (AACES), 2010-14† Early Stage ... our data show, non-responders, par-ticularly those patients who are deceased at ascertainment, Table 4 Descriptive characteristics of ovarian cancer cases and controls, the African American Cancer
Ngày tải lên: 14/10/2020, 15:53
Space-time clusters of breast cancer using residential histories: A Danish case–control study
... clusters of breast cancer in space and time simultaneously, adjusting at the same time for known risk factors such as parity and age at first birth A large area of elevated breast cancer risk was found ... identified in the adjusted analysis would not be attributable to geographical variation in the modelled risk factors Analyses We ran both unadjusted and adjusted analyses and all analyses were conducted ... breast cancer and two independent control groups with 3138 controls in each The average age at diagnosis for cases was 63 years, and both cases and controls lived at 4.8 addresses, on average,
Ngày tải lên: 05/11/2020, 00:03
Case-control study of HLA-G promoter methylation status, HPV infection and cervical neoplasia in Curitiba, Brazil: A pilot analysis
... T30, antisense 50CATATACCTCACGTCGCAG30; HPV18 sense 50CACTTCACTGCAAGACATAGA30, antisense 50G antisense 50ACATATACCTTTGTTT-GTCAA30; HPV33 50CAACGAGGTAGAAAGC-ATC30, antisense 50 AATGGT30 Samples ... Valentina Fiano1, Chiara Grasso1, Valentina Tarallo1, Laura De Marco1, Morena Trevisan1, Marina Barbara de Sousa Xavier2, Renata Slowik2, Newton S Carvalho3, Carlos A Maestri4, Hadriano M Lacerda1, ... methylation in a Brazilian population Association with the characteristics of the study popula-tion was also evaluated Materials and Methods Study population and sample collection A case–control study
Ngày tải lên: 05/11/2020, 08:12
The Commoditization of IT- Evidence from a Longitudinal Text Mining Study
... [Bharadwaj et al., 1999; Chang et al., 2003; Ravichandran et al., 2009] and capital intensity [Bharadwaj et al., 1999; Ravichandran et al., 2009], we consider these variables as control variables ... effects of IT strategies can appear over a long period of time as returns or profits, and can also appear in the form of intangible assets such as intellectual property and patents [Bharadwaj et al., ... using text mining has analyzed qualitative data from corporate annual reports and compared it to the quantitative data from those same reports [Back et al., 2001; Back and Vanharanta, 1999; Kloptchenko,
Ngày tải lên: 20/10/2022, 15:16
The Diesel Exhaust in Miners Study: A Nested Case–Control Study of Lung Cancer and Diesel Exhaust pptx
... study and data management; and Rebecca Stanevich and Daniel Yereb formerly of the National Institute for Occupational Safety and Health and Mustafa Dosemeci, formerly of the National Cancer Institute, ... (Table 1) The elevated risk among those with nonmalignant respiratory disease less than years before death may have been reflective of the early stages of lung cancer Statistically nonsignificant ... has been reported in studies of other occupational exposures and cancer risk (19) Possible biological explanations for a plateauing effect include saturation of metabolic activation and enhanced...
Ngày tải lên: 22/03/2014, 17:20
báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf
... leave work on time Resources Adult and Child Availability of equipment(e.g hoists) Availability of supplies (e.g dressings) Mental Health Availability of equipment (e.g audiovisual, art materials, ... satisfaction data at and 18 months using principal component analysis with varimax rotation and Kaiser normalization to ascertain whether the eight factors (Care, Staffing, Development, Relationships, ... all three branches were amalgamated into one dataset Branch was included as an independent variable in the statistical models and was a significant predictor in just one model where working as...
Ngày tải lên: 18/06/2014, 17:20