... Flavonoid Flavanol Epicatechin Catechin Epigallocatechin Epicatechin gallate Epigallocatechin Flavanone Naringin Taxifolin Flavonol Kaempferol Quercetin Myricetin Flavone Chrysin Apigenin Anthocyanidins ... Xanthophylls1 Name Phytofluene Lycopene δ-carotene β-carotene α-carotene β-cryptoxanthin α-cryptoxanthin Zeaxanthin Lutein Violazanthin Astaxanthin Characteristics Vitamin A Activity (%)2 CAROTENES Acyclic, ... referred to as acute-phase reactants and are active against serine proteinases.83 Other potentially important effects of dietary PI may occur via hormonal modulation and inactivation of trypsin and...
Ngày tải lên: 23/05/2014, 13:53
... the data file An example data file is included with the R package Read the data file using the function readDataFile Prepare and subset the data using the function prepareData Obtain starting values ... the signaling pathways increase, there are increasing opportunities for antagonistic or synergistic interactions In addition to intracellular proteins, drugs may also bind to protein targets on ... the binding of EGF to EGFR and the subsequent activation of EGFR by altering membrane organization related to lipid rafts As a last example, omega-3 fatty acids (EPA, eicosapentaenoic acid, and...
Ngày tải lên: 25/10/2013, 05:20
PLANT ASSETS,NATURAL RESOURCES AND TANGIBLE ASSETS
... related to accounting for intangible assets Indicate how plant assets, natural resources, and intangible assets are reported Chapter 10-2 Plant Assets, Natural Resources, Plant Assets, Natural ... Resources, and Intangible Assets and Intangible Assets Plant Assets Plant Assets Determining the cost of plant assets Depreciation Expenditures during useful life Plant asset disposals Chapter 10-3 Natural ... Chapter 10-35 SO Explain how to account for the disposal of a plant asset Plant Asset Disposals - Sale Plant Asset Disposals - Sale BE10-10 Prepare the journal entries to (a) update depreciation...
Ngày tải lên: 17/12/2013, 12:41
Tài liệu Báo cáo khoa học: Substrate specificity and inhibition of brassinin hydrolases, detoxifying enzymes from the plant pathogens Leptosphaeria maculans and Alternaria brassicicola ppt
... final concentration) and the known phytoalexins brassicanal A, erucalexin, rutalexin, brassilexin, cyclobrassinin and camalexin (0.10 and 0.30 mm final concentrations) The phytoalexin that displayed ... methods A and B; quantification was carried out using integration of peak areas of 3-indolylmethanamine and a calibration curve of indolyl-3-methanamine (3) Kinetic analysis and protein measurements ... phytoalexins brassicanal A, erucalexin, rutalexin, brassilexin, camalexin (chemical structures in Fig S2) and cyclobrassinin [7] Interestingly, only cyclobrassinin (Fig 8A) exhibited an inhibitory...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Plant a-amylase inhibitors and their interaction with insect a-amylases ppt
... sources against mammalian and insect a- amylases Low activity represents approximately 40% of a total activity a- Amylase inhibition Inhibitor Source Insect Fungal Plant Mammalian References Other activity ... the contrary, just against insect a- amylases In the latter case, this provides a highly speci®c potential weapon in plant defence a- AI2, AAI and some wheat inhibitors are among those naturally possessing ... step towards the discovery of an inhibitor that could be useful for generating insect-resistant transgenic plants In some cases, the a- amylase inhibitors act only against mammalian a- amylases...
Ngày tải lên: 21/02/2014, 03:20
plant functional genomics, methods and protocols
... elegans (2) has proven to be an invaluable resource to accelerate all areas of biological research In particular in plants, the Arabidopsis thaliana genome sequence has been deciphered, meeting the ... flanking DNA in plasmid form ready for DNA sequencing in only a few days (3), instead of having to construct a genomic library from a mutant plant In addition to germinal insertions, research using RescueMu ... insert BAC libraries In our laboratory, we have constructed many high-quality deep-coverage large insert BAC libraries including arabidopsis, manocot and dicot crop plants, and plant pathogens...
Ngày tải lên: 11/04/2014, 10:10
Báo cáo nghiên cứu khoa học " METHODS OF PHYTOPHTHORA ISOLATION FROM SOIL, ROOT AND INFESTED PLANT OF BLACK PEPPER AND OTHER CROPS " doc
... contained conidia were purified by culturing in carrot agar (CA: 200g carrot, 20g agar, 1000ml H2O), potato carrot agar (PCA: 20g potato, 20g carrot, 20g agar, 1000ml H2O) and corn meal agar (CMA: ... use to isolate Phytophthora 4.2 62 Drenth, A and Guest, D.I (2004), Diversity and Management of Phytophthora in Southeast Asia, Australian Centre for International Agricultural Research Canberra, ... directly isolate from infested parts of plants, specially infested roots and soil Using trap bait to determine the samples contained Phytophthora and those trap bait will be isolated in media (Table...
Ngày tải lên: 22/06/2014, 12:20
Super-hungry Mice Eat Onions and Other Painless Tricks for Memorizing Geography Facts pdf
... following pa ch re Read more about ea NORtheast WEst Washington, Oregon, Idaho, Montana, Wyoming, Colorado, Utah, Nevada, California, Hawaii, Alaska Midwest North Dakota, South Dakota, Minnesota, ... Delaware Barn race = Canberra Rhino saddle = Rhode Island An attic car = Antarctica Watchdogs Inn = Washington, D.C Line = Nile Bun lid = Dublin Iguana car = Nicaragua Glossary archipelago: a group ... ANtarctica, AUstralia u’ll find ing pages, yo nent On the follow out each conti e fun facts ab som AShley’s AFfectionate NAnny SAw ANdy Eat AUtos A Rhyme about Asia You’ll find mountains and plateaus,...
Ngày tải lên: 26/06/2014, 23:20
plant roots growth activity and interaction with soils
... poles Significant advances have been made in understanding the factors controlling lateral root initiation and emergence using the model plant Arabidopsis thaliana In Arabidopsis, laterals are derived ... a dependent and an independent variable in relation to being a soil-forming factor Ecologists find it useful to work with vegetation types and plant associations comprising many individual plant ... external (e.g light and gravity) and internal factors, with plant hormones being part of the internal factors that play a major role in regulating growth Many hormones are produced in one tissue and...
Ngày tải lên: 06/07/2014, 15:21
Báo cáo lâm nghiệp: "Seasonal changes of plant hydraulics, water relations and growth of Aesculus hippocastanum seedlings infested by the leafminer Cameraria ohridella" ppt
... narrow chamber allowed to measure leaf gas exchange of control leaves as well as of mined and green areas even in heavily infested leaves Leaf water potential was measured of at least two leaves ... exchange and plant hydraulics were partly affected by the parasite In particular, the leaf miner attacks induced anticipated leaf senescence via increased hydraulic impairment at the leaf, petiole and ... to controls, leading to precocious leaf shedding and plant defoliation In fact, similar increases in R were observed also in control seedlings where, however, a similar increase in R was delayed...
Ngày tải lên: 08/08/2014, 00:21
báo cáo khoa học: " Distribution of short interstitial telomere motifs in two plant genomes: putative origin and function" pptx
... TTAGTGTGTGTGATGATAGAATTTCATAAAGCTTTAACTACGAGGGGCAAAATGTTAATTCTAAATAGTTGACAGCAGAAAAA GATATGTATACATAATATAAGGATTAAAACGTAAATAATAATAAATAAGGCGAGTTAAATTAAAACCCTGTTAAAACCCTA… O.sativa rRNA large subunit ... TTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTAGTTGCTGCGAAACTCTGAAAAAGATG AT1G80890 – unknown protein TAGGGCCCATTTTAGATTTCTTTAAAAGATCCGAGAGAGAGAGGGATCTAATTCCTGATAAACCCTAGAAGAAGAAGA AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGCAAAACCTGTGGAGATCGAGATG Os07g08330 ... TGGGCCTAATTTGTGAAAAGGCCCAACAAACAAGAGCCGTCAGATCAGAATGAAGCAAACAGGCACGAACCGTTAGATTAA GATTCACAAAGAAAACCCTAGAGGTTCCCTTATCCTCAGGCCAAATCGTGAACTATAAAACGGCTGATACCAAAACCCTAA TTTCTTTA… B – rRNA processing protein coding...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Modification of tobacco plant development by sense and antisense expression of the tomato viroid-induced AGC VIIIa protein kinase PKV suggests involvement in gibberellin signaling" doc
... 5'-ACCACTTGAGTATAATGTC-3' " " " Pr1bF 5'-CAAAATTCACCCCAAGACTA-3' X12486 Pr1b 300 LAPF 5'-ATGCAGAACATGTATGTGCAG-3' SLU50151 LAP 397 LAPR 5'-TTTGCTGCACCTAAAACAGC-3' " " " ACTRQF 5'-GTGGCGGTTCGACTATGTTT-3' ... oxidase 153 GA20RQR 5'-GGCGTTGGAGATGATATTA-3' " " " GA3RQF 5'-TCAAAGAAGGGAGTGGTTGG-3' AB032198 GA3β hydroxylase 155 GA3RQR 5'-GGCTACAGAAAGGCGATGTC-3' " " " NTH15RQF 5'-CCCTCAGGCTGAAGATCAAG-3' AB004785 ... kDa serine-threonine protein kinase (PKV) In addition to protein kinase signature motifs, PKV contains a putative nuclear localization signal and a potential transmembrane spanning region (indicated...
Ngày tải lên: 12/08/2014, 03:21
báo cáo khoa học: " Complete DNA sequences of the plastid genomes of two parasitic flowering plant species, Cuscuta reflexa and Cuscuta gronovii" pdf
... in the nonphotosynthetic plant Epifagus virginiana Plant Mol Biol 1995, 29:721-733 Shinozaki K, Ohme M, Tanaka M, Wakasugi T, Hayashida N, Matsubayashi T, Zaita N, Chunwongse J, Obokata J, Yamaguchi-Shinozaki ... chloroplasts Plant Physiol 1994, 104:1119-1129 Nagashima A, Hanaoka M, Shikanai T, Fujiwara M, Kanamaru K, Takahashi H, Tanaka K: The multiple-stress responsive plastid sigma factor, SIG5, directs activation ... advanced adaptation to a parasitic lifestyle Conclusion In the case of phototrophic organisms, parasitism dramatically influences the plant as well as the plastid morphology as seen in the case...
Ngày tải lên: 12/08/2014, 05:20
BE AWARE !!! IF YOU EAT MENTOS AND DRINK COKE SIMULTANEOUSLY, ... 08/13/2011
... “PLEASE PASS THIS INFORMATION TO AS MANY PEOPLE AS POSSIBLE SPECIALLY TO THE CHILDREN.” FORWARDED BY FGMLTML 08/13/2011 ...
Ngày tải lên: 20/10/2014, 19:00
Financial accounting chapter 09 plant assets, natural resources, and intangible assets
... decline in service potential of the asset in a rational and systematic manner 9-27 LO Revaluation of Plant Assets IFRS allows companies to revalue plant assets to fair value at the reporting date ... grant Legal fees incurred successfully defending a patent are capitalized to Patent account LO Explain the basic issues related to accounting for intangible assets Accounting for Intangible Assets ... Plant Assets Plant assets are resources that have physical substance (a definite size and shape), are used in the operations of a business, are not intended for sale to customers, are...
Ngày tải lên: 07/06/2015, 03:53
Identification of plant as a novel and alternative host model for burkholderia pseudomallei
... GAATTCCTCGAACCGTCCATCGTC 60.0 KHWTTSS2P2 GGATCCGATCGTGTCGAACGAGATCA 60.0 KHWTTSS2P3 GGATCCGGCATCGACGGTATTCT 66.9 KHWTTSS2P4 AAGCTTATATCGCCGGGATAGCGTA 66.9 BTTTSS2P1 aaGAATTCGGTGGCCTCCAGAAACAGT ... constant shaking at 180 rpm in a 37 oC incubator 3.2.3 Infection of tomato, rice and Arabidopsis plantlets Tomato, rice and Arabidopsis plantlets were infected with log phase bacterial cultures at ... and gorillas (Sprague and Neubauer, 2004) Cases in animals have been reported in several countries including Australia, China, Thailand, Iran, Saudi Arabia, South Africa, Brazil and France One...
Ngày tải lên: 09/10/2015, 10:49
ảNH HƯởNG CủA MậT Độ GIEO TRồNG ĐếN CáC CHỉ TIÊU SINH Lý Và NĂNG SUấT CủA GIốNG BÔNG VN35KS Effect of Plant Density on Cotton Physiological Characters and Seed
... of cotton leaf area index to plant growth and fruiting, Agronomy Journal 57, pp 61-64 Gomez K Wanchai A and Gomez Arturo A (1984) Statistical Procedures for Agricuktural Research, Awiley Interscience ... Awiley Interscience Publication JOHN WILEY & SONS Michigan State University (1986) MSTATC: Microcomputer statistical program experimental design data management data analysis 741 ... (t/ha) LAI 5.45 120 100 3.65 3.95 4.13 102.63 80 80.4 87.86 LAI Nng sut sinh vt hc (t/ha) 120.17 60 40 20 0 2.5 cõy/ha 5.0 cõy/ha 7.5 cõy/ha 10.0 cõy/ha Mt Hình Quan hệ LAI tối a v suất sinh...
Ngày tải lên: 28/08/2013, 14:15
Occurrence of Tetracycline-Resistant and Tetracycline- Degrading Bacteria in Wastewater Treatment Plant Effluent and Environmental Water Systems
... tetracycline-degrading bacteria and the mechanism of tetracycline degradation MATERIALS AND METHODS Water samples were collected from the effluent of a small wastewater treatment plant with an activated ... Ishikawa The samples were stored in an ice box or in a refrigerator maintained at 4°C We started the experiment within 24 h of sampling Tetracycline hydrochloride (Tokyo Chemical Industry, Japan) ... water samples, incubated the samples in the laboratory, and determined the degradation rates and bacterial growth in each sample for the analysis of the growth of tetracycline-resistant or tetracycline-degrading...
Ngày tải lên: 05/09/2013, 10:15