characteristics of network media used in ethernet

A study of the linguistic features of saying verbs used in political documents in english and vietnamese

A study of the linguistic features of saying verbs used in political documents in english and vietnamese

... were used to find out the similarities and differences in the important part in finding the result of the research to produce a linguistic features of SAYING verbs used in political documents in ... or succeed Table 4.11: Verbs of Directing English Verbs of Directing Vietnamese Verbs of Directing In the process of saying these verbs of declaring are realized in the formula: [SAYER + V.P ... classify the various meanings expressed by the saying verbs used in political documents in English and Vietnamese the Linguistic Features of Saying Verbs Used in Political SCOPE OF THE STUDY This study

Ngày tải lên: 26/11/2013, 13:19

13 836 3
A STUDY ON TRANSLATION OF TYPICAL TERMS USED IN LABOR LAW FROM VIETNAMESE INTO ENGLISH

A STUDY ON TRANSLATION OF TYPICAL TERMS USED IN LABOR LAW FROM VIETNAMESE INTO ENGLISH

... typical terms of Labor Law In the process of studying English, the researcher find difficult in understanding and translating meanings of term in general Because a lot of terms are used with connected ... language message, first in terms of meaning and secondly in terms of style _Nida (1984:83)_  Translation involves the transfer of meaning from a text in one language into a text in another language ... public employees working in the administrative and public-service agencies of the Ministry of Defense and the Ministry of Public Security) The reduction of indirect payroll in the State enterprises

Ngày tải lên: 11/12/2013, 23:55

71 719 3
Analysis of colloquial language used in conversation in the textbook streamline english departures

Analysis of colloquial language used in conversation in the textbook streamline english departures

... II: COLLOQUIALISM IN SOME CONVERSATIONS IN “STREAMLINE ENGLISH DEPARTURES” 19 I Colloquial words 19 Definition of colloquial words language 19 Types of colloquial words ... phản biện ACKNOWLEDGEMENTS During the process of completing this graduation paper, I received a lot of help, guidance, and encouragement from many people First of all, I would like to express ... Mrs Nguyen Thi Phuong Thu – the lecturer of the Department of Foreign Language of Hai Phong Private University, who directly instructed me for her highly professional guidance at all stages Secondly,

Ngày tải lên: 11/12/2013, 23:57

60 674 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice_2 pot

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice_2 pot

... medicine Most of these subspecialties remained embedded in the departments of medi-cine, although departments of emergency medicine and oncology became sepa-rate departments in many institutions In ... well-defined goal of improv-ing patient care This type of initiative must involve the board of trustees of both the hospital and the university The boards must commit to and be actively involved in ... external experts in healthcare management to assist in developing a strategic plan for integration in order to avoid internal politics Include All Stakeholders in the Process of Integration All

Ngày tải lên: 21/06/2014, 14:20

26 352 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice_6 pot

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice_6 pot

... approach by entering into an agreement to join Carnegie Mellon University in developing innovative computer and software research and investment in a Carnegie Mellon spin-off that uses software to ... always in the best interest of patients and subjects of clinical trials However, in the face of a global financial meltdown, when larger pharmaceutical companies are laying off staff and funding ... Because of this, U.S teaching hospitals must increase their number of postgraduate training slots annually for a period of 10 years to reach a total of 35,000 trainees by 2020 in order even to begin

Ngày tải lên: 21/06/2014, 14:20

26 377 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice_10 pot

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice_10 pot

... banks, investors, and rating agencies while exploring methods of acquiring increased dollars for capital projects Other opportunities include restructuring long-term debt and unwinding risky investment ... Cunningham, J P., Valerio, S., Lewis, T J., and Gonnella, J S 2001 Minimum instructional and program-specific administrative costs of educating residents in internal medicine Archives of Internal ... AMCs are financially challenged because of decreased ments from payers, decreased funding for research, increased numbers of unin-sured patients, declines in investment revenues, and increased

Ngày tải lên: 21/06/2014, 14:20

26 415 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice_11 docx

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice_11 docx

... institutions; increase joint research and training grants; enhance the quality and quantity of services for the patients of Nashville General; and jointly provide new ways of maintaining the health of ... integrity of each institution. Faculty appointments, including the appointment of a new chief of surgery at Meharry, were made jointly by both institutions; economies 250  Pursuing Excellence in ... strengths of each of the partners. Indeed, the success of the program was seen in the ability of the departments of sur- gery to form a joint department while at the same time preserving the integrity

Ngày tải lên: 21/06/2014, 14:20

26 341 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice_12 doc

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice_12 doc

... Oversight of the AMC  275 alternative fuels, building windmills and solar panels, and replacing existing environmental systems with fuel-efficient heating or cooling systems. Investing in the infrastructure ... University of Pittsburgh School of Medicine as the Harry S Tack Professor of Medicine, chief of the Division of Cardiology, and director of the Cardiovascular Institute of the ... developing multidisciplinary teams to evaluate professionalism. Sphere of Action IV: Business ◾ Chapter 10: Develop innovative ways to finance the various missions of the AMC, including documenting

Ngày tải lên: 21/06/2014, 14:20

20 279 0
Brief summary of engineering doctoral thesis: Analysis of influencing parameters and basics of determining resistance factors of drilled shafts used in bridge substructures in Ho Chi Minh city

Brief summary of engineering doctoral thesis: Analysis of influencing parameters and basics of determining resistance factors of drilled shafts used in bridge substructures in Ho Chi Minh city

... Trang 1MINISTER OF EDUCATION AND TRAINING UNIVERSITY OF TRANSPORT AND COMMUNICATIONS NGO CHAU PHUONG ANALYSIS OF INFLUENCING PARAMETERS AND BASICS OF DETERMINING RESISTANCE FACTORS OF DRILLED ... parameters that influence the results of determining of pile resistance factors described in Figure 3.1 Figure 3.1 Parameters influencing to determinging of resistance factors (φ) 3.1 Uncertainty factors ... to determine pile resistance factors as shown in item 2.4 Chapter 3 ANALYZING THE PARAMETERS INFLUENCING TO RESISTANCE FACTORS OF DRILLED SHAFTS USED IN BRIDGE SUBSTRUCTURES IN HO CHI MINH CITY

Ngày tải lên: 02/07/2014, 20:32

27 598 1
Báo cáo lâm nghiệp: "Characteristics of coarse woody debris in successional stages of natural beech (Fagus orientalis) forests of Northern Iran" ppsx

Báo cáo lâm nghiệp: "Characteristics of coarse woody debris in successional stages of natural beech (Fagus orientalis) forests of Northern Iran" ppsx

... surrounding it. Within each plot, CWD was measured using a fixed- area plot sampling method (H, S 1996; Y et al. 2007). In the spring of 2008, three types of CWD were examined according ... example, in LS forest. is is again confirmed by the high proportion of stumps of C. betulus in MS forest. After examining the distribution pattern of CWD in the forests of southern South America, ... proportion of woody residues was in advanced decomposition classes in the early stages of succession, while the majority was in the intermediate decomposition classes in older stands. In contrast,

Ngày tải lên: 07/08/2014, 10:21

11 268 0
Báo cáo lâm nghiệp: " Dynamics of tree species composition and characteristics of available space utilization in the natural forest of the National Nature Reserve Hrončokovský Grúň" pot

Báo cáo lâm nghiệp: " Dynamics of tree species composition and characteristics of available space utilization in the natural forest of the National Nature Reserve Hrončokovský Grúň" pot

... mechanism, the trees of the previous generation are dying off, including fir Dynamics of diameter structure in natural forest To explain the mechanisms of tree species persis-tence during the observation ... relatively fast dying-off of the older fir genera-tion The individuals of the subsequent generation of fir growing in the lower layer become damaged to various degrees by falling trees of the previous ... situation at PRP 2 (initial phase of the break-down stage) is characterized in Table 2 In spite of the sporadic presence of spruce in the upper layer in 1972, beech is a dominant species Other

Ngày tải lên: 07/08/2014, 10:22

12 352 0
Studies on the morphology and melocular characteristics of small intestinal trematodes in human in some provinces and effective treatment in community (2010   2013)

Studies on the morphology and melocular characteristics of small intestinal trematodes in human in some provinces and effective treatment in community (2010 2013)

... species of small intestinal trematodes recorded in Thailand, while 12 species in thePhilippines; 8 species in Indonesia and 4 species in Malaysia, respectively.Many species of small intestinal trematodes ... to determine, identify, and confirm the small intestinetrematodes of Heterophyidae and Echinostomatidae in people in 9 provinces in Vietnam On the other hand, the thesis indicated the interactive ... aims as: 1 To determine the species composition, descriptions of themorphological characteristic of small intestinal flukes in some provinces ofVietnam 2 To identify the intestinal fluke species

Ngày tải lên: 29/10/2014, 22:15

24 502 0
Evaluation of institutional method used in teaching of english in secondary schools of Haripur District

Evaluation of institutional method used in teaching of english in secondary schools of Haripur District

... DEVELOPMENT Following are the ways of improving one’s knowledge of ELT and thereby increasing one’s confident as a teacher. i. Subscribing to ELT magazines and journals ii. Joining professional organizations ... objectives of the study. 1. To evaluate the effectiveness of teaching of English at secondary level. 2. To determine the extent of availability of instructional aids in teaching of English. 3. ... distinguishing factor is often the way in which the instructional content is used in the actual teaching procedure. The main characteristics, differences, strengths and weakness of individual...

Ngày tải lên: 10/04/2013, 10:37

69 590 0
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc

Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc

... quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72, 248–254. 43 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage ... GCCGAATTCTCCTCAGCATGTCCAG (located upstream of hbpS and ending at the 5¢-end of binding site II) D IIEcofor CGAGAATTCGGGGGCGTCGGTCGC (located upstream of hbpS and beginning at the 3¢-end of binding site II) IIPstrev ... loops for sensing [2]. In addition to the N-terminal input domain, SKs contain a C-terminal portion representing the transmitter mod- ule, with several blocks of amino acid residues being conserved...

Ngày tải lên: 07/03/2014, 10:20

14 429 0
Báo cáo " Morpho- structure characteristics of some karst caves in Yen Mo- Tam Diep area, Ninh Binh province Doan Dinh Lam" docx

Báo cáo " Morpho- structure characteristics of some karst caves in Yen Mo- Tam Diep area, Ninh Binh province Doan Dinh Lam" docx

... 141 Morpho- structure characteristics of some karst caves in Yen Mo- Tam Diep area, Ninh Binh province Doan Dinh Lam Institute of Geological Sciences, Vietnamese Academy of Science and Technology ... evaluate tourism potential of Ninh Binh’s caves system for tourism planning and development in the next future, during 2005-2007 Ninh Binh Tourism Department and Institute of Geological Sciences ... were investigated and study results are effectively used for tourism development in this area. However, with increasing tourism demand in Ninh Binh and many caves were discovered in Yen...

Ngày tải lên: 14/03/2014, 15:20

25 343 0

Bạn có muốn tìm thêm với từ khóa:

w