cell biomaterial interactions at the micro and nanoscale

biomechanics at micro- and nanoscale levels, v.iii, 2007, p.182

biomechanics at micro- and nanoscale levels, v.iii, 2007, p.182

... but rather by the interaction between the micro- or nanoscale structures in cells and the genetic code, the dynamic interaction between them being especially important Therefore, if the relationship ... intracellularly through the patch electrode Arrow indicates the moment when the cell s membrane was ruptured and streptomycin started to diffuse to the cytosol of the cell The cell was held at ... propagate from a single stimulated bone cell (cell #1) to adjacent cells micropatterned in the network configuration at both 50 and 75µm separation distances (Fig 6) Some neighboring cells (#3 and...

Ngày tải lên: 04/06/2014, 14:19

182 578 0
biomechanics at micro- and nanoscale levels, v.iv, 2007, p.181

biomechanics at micro- and nanoscale levels, v.iv, 2007, p.181

... but rather by the interaction between the micro- or nanoscale structures in cells and the genetic code, the dynamic interaction between them being especially important Therefore, if the relationship ... recorded on the DVD recorder via the CCD camera during tensile testing After the tensile test, the distance between the micropipette and microplate L, the deflection of each microplate X, and the diameter ... lower migratory activity induced cell aggregates in the rigid gel The cells then gradually migrated into the gel and formed aggregates (Figs 3C and 4D) To develop into networks, the cells extended...

Ngày tải lên: 04/06/2014, 14:42

181 432 0
Báo cáo hóa học: " Stretching and immobilization of DNA for studies of protein–DNA interactions at the single-molecule level" ppt

Báo cáo hóa học: " Stretching and immobilization of DNA for studies of protein–DNA interactions at the single-molecule level" ppt

... during the synthesis and show a decrease in the replication rate when the force exceeds pN The decrease in the replication rate is attributed to the work that DNAP has to perform against the external ... of the DNA; then the DNA molecule is stretched out by the force exerted on the rest of the DNA by the receding meniscus; and finally the other end also sticks to the substrate as it dries The ... attachment to the gold electrode After immobilization the DNA molecules were stretched and anchored at the other end using a MHz field The stretching that occurred at MHz might have arisen either...

Ngày tải lên: 22/06/2014, 18:20

17 354 0
Báo cáo y học: " Classic swine fever virus NS2 protein leads to the induction of cell cycle arrest at S-phase and endoplasmic reticulum stress" potx

Báo cáo y học: " Classic swine fever virus NS2 protein leads to the induction of cell cycle arrest at S-phase and endoplasmic reticulum stress" potx

... no data exists on the subcellular localization of CSFV NS2 protein and its effects on cell growth and cell cycle progression The swine endothelial vascular cell is one of the CSFV target cells, ... NS2-GFP-expressing and control cells and suggests that the CSFV NS2 protein induced cell cycle arrest in the S-phase, rather than inducing apoptosis The results showed that relative to control cells, NS2 ... proteins from the ER to the cytosol for ubiquitylation and proteasome-mediated degradation [29-31], taken together, we speculate that the CSFV NS2-expressing cells accelerated the retrograde...

Ngày tải lên: 12/08/2014, 04:21

12 304 0
Tài liệu The Acquisition of Drugs and Biologics for Chemical and Biological Warfare Defense - Department of Defense Interactions with the Food and Drug Administration doc

Tài liệu The Acquisition of Drugs and Biologics for Chemical and Biological Warfare Defense - Department of Defense Interactions with the Food and Drug Administration doc

... the interactions related to the use of INDs in combat (and other special) situations in which the threat of enemy use of chemical and/ or biological agents is genuine However, many CBW drugs and ... the National Defense Research Institute The latter is a federally funded research and development center sponsored by OSD, the Joint Staff, the unified commands, and the defense agencies in the ... Act, and the implementing regulations of these statutes, regulates the testing of drugs for safety and effectiveness in all stages of development The agency prescribes the manufacturing standards...

Ngày tải lên: 17/02/2014, 11:20

99 605 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ... ACACTCGAGAGATCTGCAAATGAATATG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC ... AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTAAGACTCATCCCAACTAC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTGGATATGAAAATGTTTCGG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ACACTCGAGAGATCTGCAAATGAATATG...

Ngày tải lên: 07/03/2014, 15:20

9 418 0
Báo cáo khoa học: Insulin resistance in human adipocytes occurs downstream of IRS1 after surgical cell isolation but at the 1 level of phosphorylation of IRS1 in type 2 diabetes pot

Báo cáo khoa học: Insulin resistance in human adipocytes occurs downstream of IRS1 after surgical cell isolation but at the 1 level of phosphorylation of IRS1 in type 2 diabetes pot

... affected by cell isolation procedures and prolonged incubations in the same way as rat and mouse [26] cells The insulin-sensitivity for phosphorylation of the insulin receptor and the immediate downstream ... controls subjects and type diabetic patients after overnight incubation Cells were incubated overnight and then with the indicated concentration of insulin for 10 before whole -cell lysates were subjected ... overnight incubation When the insulin-responsiveness of the cells was examined at different concentrations of insulin, we found that insulin enhanced the phosphorylation of PKB at lower concentrations...

Ngày tải lên: 07/03/2014, 16:20

11 475 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG GGGCGGATCCTCTGCTTTTCTTTATC CTGGACACAGCCACGCAGTATACAGCATACTATAACGG CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG ... by the b domain In addition, mutation of the b domain strengthens interactions with the MIT domain Thus our data offer the first evidence that there may be functional interactions between the ... features The interaction of Bro1 with Vps4p is regulated by ATP binding rather than hydrolysis, and interaction of Did2p with Vps4p is regulated by neither ATP binding nor ATP hydrolysis Our data...

Ngày tải lên: 23/03/2014, 09:20

14 371 0
Báo cáo khoa học: Aromatic amino-acid residues at the active and peripheral anionic sites control the binding of E2020 (AriceptÒ) to cholinesterases doc

Báo cáo khoa học: Aromatic amino-acid residues at the active and peripheral anionic sites control the binding of E2020 (AriceptÒ) to cholinesterases doc

... Trp84 at the bottom of the gorge, the piperidine ring interacts with Tyr70, Asp72, Tyr121 and Tyr334 in the middle of the gorge, and the indanone ring interacts with Trp279 at the lip of the gorge ... BChE, the interaction of the phenyl ring of E2020 at the active-site has to be compromised These results suggest that the larger dimension of the BChE gorge and the lack of aromatic residues in the ... workstation using the molecular simulation software INSIGHT II The coordinates of Mo AChE–(R)-E2020 complex were generated using the crystal structure coordinates from the Protein Data Bank The...

Ngày tải lên: 30/03/2014, 20:20

12 503 0
Looking at the label and beyond: the effects of calorie labels, health consciousness, and demographics on caloric intake in restaurants

Looking at the label and beyond: the effects of calorie labels, health consciousness, and demographics on caloric intake in restaurants

... what people eat once inside the restaurant, a gap the present study aims to fill In this paper, we also investigate the effect of the format in which calories are displayed on menu labels The ... in the control menu treatment received no nutritional information, patrons in the calorie-only menu treatment were provided the number of calories in parentheses before each item’s price, and ... in the calorie+traffic light treatment was −52.48 + 38.16 = −14.32, so the negative relationship continued to hold but at a lower absolute magnitude Alternatively, in the calorie-only treatment,...

Ngày tải lên: 08/04/2014, 18:33

9 420 0
ecstasy the complete guide a comprehensive look at the risks and benefits of mdma

ecstasy the complete guide a comprehensive look at the risks and benefits of mdma

... psychiatric literature as the "capacity to understand what another person is experiencing from within the other's frame of reference (standing in the other's shoes) In empathy one feels as the other ... to the transporter, the transporter changes shape (or configuration) and moves the 5-HT to the inside of the cell, where the 5-HT "falls off' and is released into the cytoplasm of the cell The ... general psychotherapeutic value of MDMA was "very positive." More than three fourths of these therapists stated that their patients had improved greatly in insight-based therapies and that the overall...

Ngày tải lên: 03/07/2014, 16:07

462 763 1
Báo cáo y học: "The role played by cell-substrate interactions in the pathogenesis of osteoclast-mediated peri-implant osteolysis" potx

Báo cáo y học: "The role played by cell-substrate interactions in the pathogenesis of osteoclast-mediated peri-implant osteolysis" potx

... differentiation Cathepsin K and tartrate-resistant acid phosphatase (TRAP) are among the enzymes that are expressed in these cells and contribute to the resorption of the extracellular matrix component ... polymethylmethacrylate into soft tissues of rats and analyzed the phenotypic features of the elicited cells We observed that the particulate polymeric materials failed to induce cells with the full phenotypic and ... morphology These cells fail to express the CD68 antigen and are not believed to be of hematopoietic origin The association of the fibroblastic cells with the bone surface and the ex vivo demonstration...

Ngày tải lên: 09/08/2014, 07:20

10 386 0
Báo cáo y học: "Clinical review: Drotrecogin alfa (activated) as adjunctive therapy for severe sepsis – practical aspects at the bedside and patient identification Pierre-François Laterre and Xavier Wittebole" pdf

Báo cáo y học: "Clinical review: Drotrecogin alfa (activated) as adjunctive therapy for severe sepsis – practical aspects at the bedside and patient identification Pierre-François Laterre and Xavier Wittebole" pdf

... implies that the benefit of the drug after this delay has not been evaluated Prolonging the waiting period between initiating adequate standard care and evaluating whether the drug is indicated is ... In the PROWESS study, three patients had an ICH (one patient receiving the placebo and two receiving drotrecogin alfa [activated]) [1] For these latter patients, clinically evident disseminated ... serum concentration and drug half-life did not differ between patients with renal failure and the population overall [17] Based on these data, patients with end-stage renal failure and chronic...

Ngày tải lên: 12/08/2014, 19:22

6 313 0
communication style at the vietnamese and american workplace = phong cách giao tiếp công sở ở việt nam và mỹ

communication style at the vietnamese and american workplace = phong cách giao tiếp công sở ở việt nam và mỹ

... communication style at the workplace? - What are the similarities and differences in the communication style at the Vietnamese and American workplace? 1.3 Significance of the study It is hoped that ... presents the rationale, the objectives, the scope, the significance, the methods and the design of the study Chapter 2: Theoretical background starts with the definitions of culture, communication and ... consideration It is the ways that are used within the organization to help colleagues to transmit messages and information Organization uses communication system to link people together and make them...

Ngày tải lên: 02/03/2015, 14:30

58 1,2K 5
A research on evaluating User satisfaction when applying the VANPRO software at the education and training of Dien Bien Province

A research on evaluating User satisfaction when applying the VANPRO software at the education and training of Dien Bien Province

... applications in the planning Application of information technology in data collection, analysis and assessment of the state of education is very important and necessary for planning If the state ... annual and five-year period of the school, the Education and Training, the Department of Education and Training This software helps the user to collect and forecast the number of school-age population, ... state of education is appreciated, we will identify the objectives and targets of the plan At the same time, we will also have the solution, good for the development of education policy Therefore,...

Ngày tải lên: 20/07/2015, 21:08

30 394 0
Communication style at the Vietnamese and American workplace

Communication style at the Vietnamese and American workplace

... implication for people working in intercultural working environment, the limitations of the study in which the author states the reasons for the study’s limitations, and suggestions for further ... reasons for the selection and the description of the participants; the data collection instruments in which the instrument and procedure of data analysis are discussed; methods of data collection ... communication style, which leads to problems occurring when Vietnamese and American people communicate at the workplace Then, the findings are analyzed and discussed Chapter 5: Conclusion presents the...

Ngày tải lên: 10/08/2015, 19:51

6 1,6K 39
Estrogen receptor a mediated long rang chromatin interactions at the ret gene locus in breast cancer

Estrogen receptor a mediated long rang chromatin interactions at the ret gene locus in breast cancer

... approximately the cells were then washed from the surface of the flask with ml of the passage medium and then pipette up and down repeatedly to obtain single cell suspension The MCF7 cells were then ... overnight Then µl of the 10× ligation buffer and µl of the ligase was added into the tube to ligate the fragments The tube was incubated at 16 ℃ for hours then left at room temperature for hour The ... were heated to 65℃ to deactivate the enzyme and then ligation buffer and T4 ligase (New England Biolabs) were added into the samples Samples were incubated in 16℃ for at least hours, then at room...

Ngày tải lên: 05/10/2015, 21:29

90 412 0
AN EMPIRICAL INVESTIGATION INTO THE FACTORS CRITICAL TO THE EFFECTIVENESS OF ABS IMPLEMENTATION AT THE NATIONAL AND INTERNATIONAL LEVELS

AN EMPIRICAL INVESTIGATION INTO THE FACTORS CRITICAL TO THE EFFECTIVENESS OF ABS IMPLEMENTATION AT THE NATIONAL AND INTERNATIONAL LEVELS

... influenced the debate during the CBD negotiations and one can even go further, by saying that, it continued to influence the implementation of the CBD both at the national and international level ... in the CBD during the work of the ABS working group, which had the mandate to negotiate the international regime,now known as the Nagoya Protocol This is essential since the finalization The ... combination of literature review, desk studies, surveys and expert interviews was carried out to look at the s state of the art and to provide the theoretical foundation for the study and empirical...

Ngày tải lên: 02/12/2015, 01:11

363 336 0
w