... serine (R27aS) in B3Vλ CDR1 resulted in a significant reduction in dsDNA binding, indicating the importance of this arginine at the binding site [15,23] When an extra arginine was introduced into ... control half and incubated for hour at 37°C The plates were washed again with PBST Bound antibody was detected by adding goat antihuman IgG alkaline phosphatase conjugate and incubating for hour at ... Guth and colleagues [12] showed that arginine-to-serine mutations in VHCDR3 of SN5-18 ablate binding to chromatin The single arginine-to-serine mutation in B3(R27aS)VL did not ablate binding to...
Ngày tải lên: 09/08/2014, 06:23
... Sel-tag [18] Der p carrying the Sel-tag had an intact core sequence and maintained allergen-specific IgE-binding epitopes and the use of a Sel-tag enabled labelling with the gamma-emitting radionuclide ... eosinophilic airway in ammation [28–30] Trafficking of dendritic cells to the airways and the lung epithelium was also demonstrated to be dramatically increased in mice with an allergic airway in ammation, ... metabolism of the allergen was altered as a result of the in ammation in the lungs of sensitized animals Up to now there are few data available on the fate of an allergen after inhalation In...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: The N-terminal cysteine pair of yeast sulfhydryl oxidase Erv1p is essential for in vivo activity and interacts with the primary redox centre doc
... 5¢-GGTGGTA GATGATCGGCAAGGTTTGC-3¢), C130S (forward 5¢CCAATTGGTGTGCTAAAGACTTTG-3¢/reverse 5¢-AA GGATAAATATGTGAGAAGATATTC-3¢), C133 (forward 5¢-CTTTGAAAAATATATCAGAGAAAATG-3¢/ reverse 5¢-TCTTTAGCAGACCAGTTGTAAGG-3¢), ... 5¢-TCTTTAGCAGACCAGTTGTAAGG-3¢), C159S (forward 5¢-GCCCACAATAAAGTCAATAAG AAAT-3¢/reverse 5¢-CTCAGACATCCACCTCCCAAG TTCTT-3¢), C176S (forward 5¢-CTCCAATTTCTGG GAAAAAAGATGGAAG- 3¢/reverse 5¢-TCAAATTTGG GCTTCCTCAATTTC-3¢) ... explain this finding The similar FAD binding and the absence of unspecific, large aggregates on the SDS/PAGE argue against a general misfold of the protein Thus, the fact that the mutant cannot...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo hóa học: "Multicenter phase II study of matured dendritic cells pulsed with melanoma cell line lysates in patients with advanced melanoma" potx
... USA 3IDM Pharma Inc (IDM), Irvine, CA, USA 4Arizona Cancer Center, Tucson, AZ, USA 5Hillman Cancer Center, Pittsburgh, PA, USA Lutheran General Cancer Care Centre, Park Ridge, IL, USA 7AAI Pharma ... responses, 26 patients (90%) had detectable TAA-specific CD8+ T cells in peripheral Table Summary of characteristics of patients showing clinical response Stage Prior treatment Best Response1 Patient ... 2fold increase over baseline at one (or more) time points post-treatment The data are summarized in the Additional file 2, Table S2 Among 26 patients with detectable TAA-specific CD8+ T cells, ...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " Are quantum dots ready for in vivo imaging in human subjects?" docx
... self-assembly using engineered proteins [51–54] Research has shown that a three-layer method using an antibody against a specific target, a biotinylated secondary antibody against the primary antibody, ... differ only at a single nucleotide [114, 115] In comparison with planar chips, bead-based multiplexing has many distinct advantages such as greater statistical analysis, faster assay time, and the ... 96] Although FRET measurements using QDs can convey qualitative molecular association information and appear to have great potential as nanoscale biosensors, there are also a number of limitations...
Ngày tải lên: 22/06/2014, 18:20
báo cáo khoa học: " Manufacture of IRDye800CW-coupled Fe3O4 nanoparticles and their applications in cell labeling and in vivo imaging" ppt
... clinical application Page of 14 In particular, these biological processes should be investigated in a dynamic and real-time form with living animals In recent years, NIRF labeling has played an ... magnetic resonance imaging and biodegradability of superparamagnetic core-shell nanoparticles Biomaterials 2010, 31:1316-1324 19 Hatanaka S, Matsushita N, Abe M, Nishimura K, Hasegawa M, Handa H: Direct ... contained an increasing number of progressively larger phagolysosomes containing magnetic nanoparticles days after injection, and the macrophages in the spleen contained magnetic nanoparticles in lysosomes...
Ngày tải lên: 11/08/2014, 00:22
báo cáo khoa học: "BRCAA1 monoclonal antibody conjugated fluorescent magnetic nanoparticles for in vivo targeted magnetofluorescent imaging of gastric cancer" ppsx
... irradiation, and have great potential in applications such as simultaneous imaging and targeting therapy of clinical gastric cancer in near future Materials and methods Preparation of anti-BRCAA1 ... shown in Table 2, the average coupling rate of anti-BRCAA1 antibody with FMNPsCOOH was 80.28% As-prepared nanoprobes for in vitro targeted gastric cancer cells Targeting ability of as-prepared nanoprobes ... paper, we fully use the advantages of FMNPs and BRCAA1 antigen, prepared monoclonal antibody against BRCAA1 protein, and prepared BRCAA1 monoclonal antibody-conjugated fluorescent magnetic nanoprobes...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: " Identification of unique reciprocal and non reciprocal cross packaging relationships between HIV-1, HIV-2 and SIV reveals an efficient SIV/HIV-2 lentiviral vector system with highly favourable features for in vivo testing and clinical usa
... carried out as in two stages using the following primers: stage 1, upstream mutagenesis:- 5'GGAATACCATTTAGTTAAAGATCTGAACAGCTATACTTGGTCAGGG-3' and :5'-CCCTGA CCAAGTATAGCTGTTCAGATCTTTAACTAAATGGTATTC C-3'; ... for stage 2, downstream mutagenesis, 5'CGCCCTCATATTCTCTGTATAGATCTACCCGCTAGCTTGCATTG-3' and 5'-CAATGCAAGCTAGCGGGTAGATCTATACAGAGAATATGAGGGCG-3' The 141 bp U3 region was removed from the plasmid ... signal may act as a subcellular localisatio signal as well as a high affinity binding site for Gag The resulting RNAprotein complex is then targeted to the plasma membrane where virion budding takes...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: " A remission spectroscopy system for in vivo monitoring of hemoglobin oxygen saturation in murine hepatic sinusoids, in early systemic inflammation" doc
... depicted in Figure Hepatic tissue injury Serum alanine aminotransferase (ALT) and serum aspartate aminotransferase (AST) levels are summarized in Table When compared with sham animals, mice treated ... the manufacturer Measurement of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels Blood was collected immediately after the microscopy procedure, via cardiac puncture ... to maintain normal mean arterial pressure As formerly described [4], and for the realization of the intravital microscopy procedure in anaesthetized animals, a transverse subcostal incision was...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: "Human T-cell leukemia virus type 2 post-transcriptional control protein p28 is required for viral infectivity and persistence in vivo" ppt
... to viral replication and viralinduced immortalization in cell culture as well as viral replication kinetics and persistence in inoculated rabbits Our findings indicate that the loss of p28 and ... entail identifying the functional domains of the protein involved in localization, protein interactions, and RNA binding as well as precisely identifying the viral mRNA response element In addition, ... of total cell lysates from transfected cells was separated by SDS-PAGE and transferred to a nitrocellulose membrane (Amersham, Piscataway, NJ) Rabbit polyclonal antibodies against p28 or a monoclonal...
Ngày tải lên: 13/08/2014, 05:20
Báo cáo toán học: "Iodine Alters Gene Expression in the MCF7 Breast Cancer Cell Line: Evidence for an Anti-Estrogen Effect of Iodine" doc
... CA) and analyzed using flow cytometry (Guava EasyCyte Mini.) RNA isolation Following iodine treatment, total RNA was isolated using RNAeasy mini kits (Qiagen, Valencia, CA) according to the manufacturer ... iodine and iodide in rat thyroid and mammary glands Biol Trace Elem Res 1995, 49:9-19 Funahashi H, Imai T, Tanaka Y, Tobinaga J, Wada M, Morita T, Yamada F, Tsukamura K, Oiwa M, Kikumori T, et al ... resulting data was annotated and analyzed using the DAVID Bioinformatics Database Gene Functional Classification Tool (NIAID/NIH) Genes with a greater than fold change in or more arrays were considered...
Ngày tải lên: 08/08/2014, 17:20
Báo cáo y học: ""Shock and kill" effects of class I-selective histone deacetylase inhibitors in combination with the glutathione synthesis inhibitor buthionine sulfoximine in cell line models for HIV-1 quiescence" doc
... acetylation and deacetylation, NF-kappaB and pro-inflammatory gene expression Biochem Pharmacol 2004, 68:1255-1267 Garaci E, Palamara AT, Ciriolo MR, D'Agostini C, Abdel-Latif MS, Aquaro S, Lafavia E, ... valproic acid [34-36] The results of these trials have been largely disappointing so far Valproic acid, a relatively weak HDACI, was tested in a small clinical trial in combination with antiretroviral ... Zhao M, Rudek MA, Mnasakanyan A, Hartke C, Pili R, Baker SD: A liquid chromatography/tandem mass spectrometry assay to quantitate MS-275 in human plasma J Pharm Biomed Anal 2007, 43:784-787 Lacreta...
Ngày tải lên: 12/08/2014, 23:21
INTERLEUKIN 6 RELEASE FROM t98g HUMAN GLIAL CELL LINE AS a PREDICTIVE MARKER FOR CHRONIC PAIN, AND THE CHARACTERIZATION OF SUBSTANCE(S) INVOLVED IN PAIN
... in modulating chronic pain Amino acids and prostaglandins are two such examples 1.2.1.1 Amino Acids Glutamate is the main excitatory amino acid in the mammalian CNS Its interaction with glutamate ... osteoarthritis (Sethuraman et al., 2007) Amino acids including aspartate, arginine, asparagine, tyrosine and valine were also demonstrated to be elevated in the CSF of chronic pain patients as ... function in sustaining the pain (Vallejo et al., 2010) An interesting finding was that nerve injury induces an increase in interleukin-18 (IL-18) and IL-18 receptors in activated microglia and astrocytes...
Ngày tải lên: 02/10/2015, 17:15
Báo cáo y học: "High level expression of apoptosis inhibitor in hepatoma cell line expressing Hepatitis
... sequence 3’-GAGGAGACAGTCCTACTGAAA (API1) and 3’-CATAGCATTATCCTTCGGTTC (API2) were used to detect cIAP2 Primers with the sequence 3’-GGGAAGCAGAGATCATTTTGC (API3) and 3’- AACTGAGTATATCCATGTCCC (API4) ... NH2-terminal prodomains, which interact with adapter molecules to form a death-inducing signaling complex Downstream caspases such as caspase-3, caspase-6, and caspase-7 are executioner caspases that ... with ethanol and caught by RNA binding spin cup After washing, DNA was degraded by the digestion of DNase Finally RNA was released from cup and stored in –70° C for use Micro-array analysis For...
Ngày tải lên: 02/11/2012, 11:17
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx
... increase in the prooxidant state caused by iron loading has an impact in protein integrity, as indicated by an increase in protein-bound acrolein adducts at the cell surface, which point to acrolein-adducts ... immunoprecipitation and mRNA studies (A) Cytospins of HepG2 cells were incubated with Nor3.2 followed by rabbit anti-(mouse Igs) and the alkaline phosphatase-antialkaline phosphatase (APAAP) conjugate, as ... and rabbit Igs were used as control to define background staining For intracellular staining, cells were first permeabilized with 0.2% saponin Labeled cells were acquired in a FACSCalibur and analyzed...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
... using the dried droplet technique and a- cyano-4-hydroxycinnamic as matrix, and analysed by using a Voyager-DE PRO mass spectrometer (Applied Biosystems, Framingham, MA, USA) Internal-mass calibration ... performed a comparative bidimensional PAGE analysis of nuclear extracts coupled to Western blotting analysis with an eEF 1A mAb As an internal normalizer of loading amounts and focusing position, ... accompanied by a dramatic increase in protein methylation at as many as nine lysine residues, without any change in the protein or mRNA levels [43] This modification, as well as other post-translational...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Insulin/protein kinase B signalling pathway upregulates metastasis-related phenotypes and molecules in H7721 human hepatocarcinoma cell line pptx
... reasonable to assume that insulin has an anti-apoptotic effect, since PKB is an important signal transducer of insulin In our laboratory, Wang et al [17] found that in a human hepatocarcinoma ... antigens, cancer assotiated antigens and fucosyltransferase Protein, Nucl Acid, Enz 48, 2394–2403 (in Japanese) 25 Sasaki, K., Kurata, K., Funayama, K., Nagata, M., Watanabe, E., Ohta, S., Hanat, N ... reveal that the insulin/PI3K/ PKB signalling pathway enhances the metastatic potential of human hepatocarcinoma cells, which is at least partially mediated by the increased expressions of metastasis-related...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Measuring enzyme activities under standardized in vivo-like conditions for systems biology pdf
... dedicated assay media We are aware of and ⁄ or involved in such standardization projects for enzyme assays for E coli, lactic acid bacteria and mammalian cells The procedure described in this article ... 121–124 Auesukaree C, Homma T, Tochio H, Shirakawa M, Kaneko Y & Harashima S (2004) Intracellular phosphate serves as a signal for the regulation of the PHO pathway in Saccharomyces cerevisiae J ... Standardized enzyme assays for systems biology 37 Nakajima-Shimada J, Iida H, Tsuji FI & Anraku Y (1991) Monitoring of intracellular calcium in Saccharomyces cerevisiae with an apoaequorin cDNA expression...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Activator-binding domains of the SWI ⁄ SNF chromatin remodeling complex characterized in vitro are required for its recruitment to promoters in vivo pot
... Recombinant activator interaction domains interact with activation domains in vitro using a two-step mechanism, where rapid ionic interaction with an unfolded activation domain is followed by a slow ... reduced in a strain lacking both the Swi1 and Snf5 activator-binding domains Recruitment of the SWI ⁄ SNF complex via activator interactions with these activator-binding domains is thus critical for ... Snf5 activator-binding domain (SNF5D2-327) and strain YPP247 (dark grey bars, DABDswi1) lacking the Swi1 activator-binding domain (SWI1D329-655), relative to the wild-type tested in parallel (black...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: In vivo RNA interference in oyster – vasa silencing inhibits germ cell development pptx
... UÆlg)1 total RNA; Sigma, Saint-Quentin, France) to prevent DNA contamination RNA concentrations were measured as described above, and RNA quality was checked with a Bioanalyser 2100 (Agilent, Massy, ... gonad (lane 6), and female gonad (lane 7) Twelve micrograms of total protein extract from each tissue was loaded into the gel A single band of about 79 kDa was detected in female and male gonads ... our data, ‘residual’ Oyvlg mRNA varied from 13% to 48% High variability in RNAi response was observed between individuals (Figs and 5) Variation in the amount of dsRNA actually penetrating into...
Ngày tải lên: 07/03/2014, 00:20